EMAIL THIS PAGE TO A FRIEND

HGD

homogentisate 1,2-dioxygenase

80 Gene Product Result for
Synonyms: AKU HGO
UniProtKB ID: Q93099, B2R8Z0
Gene ID:
Human(3081) Summary: This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.[provided by RefSeq, May 2010]
Mouse(15233) homogentisate 1, 2-dioxygenase
Rat(360719) homogentisate 1, 2-dioxygenase
Zebrafish(259189) homogentisate 1,2-dioxygenase
chicken(418330) homogentisate 1,2-dioxygenase
dog(478578) homogentisate 1,2-dioxygenase
domestic cat(101082771) homogentisate 1,2-dioxygenase
cow(507496) homogentisate 1,2-dioxygenase
Horse(100060993) homogentisate 1,2-dioxygenase
sheep(101108617) homogentisate 1,2-dioxygenase
Domestic Rabbit(100342562) homogentisate 1,2-dioxygenase
domestic guinea pig(100721056) homogentisate 1,2-dioxygenase
naked mole-rat(101696300) homogentisate 1,2-dioxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000187 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107141 MISSION® esiRNA esiRNA human HGD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000187 Rosetta Predictions human pricing
XM_930683 Rosetta Predictions human pricing
NM_001012145 Rosetta Predictions rat pricing
XM_573291 Rosetta Predictions rat pricing
NM_013547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194713 predicted 930
2 SASI_Hs01_00194715 predicted 678
3 SASI_Hs01_00194716 predicted 656
4 SASI_Hs02_00302034 predicted 1213
5 SASI_Hs01_00194718 predicted 1190
6 SASI_Hs02_00302035 predicted 584
7 SASI_Hs01_00194719 predicted 1689
8 SASI_Hs01_00194720 predicted 957
9 SASI_Hs01_00194721 predicted 888
10 SASI_Hs01_00194722 predicted 744
11 SASI_Hs01_00194714 predicted 894
12 SASI_Hs01_00194717 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257247 predicted 933
2 SASI_Hs01_00257248 predicted 1086
3 SASI_Hs01_00257249 predicted 674
4 SASI_Hs01_00257250 predicted 650
5 SASI_Hs01_00257251 predicted 1219
6 SASI_Hs01_00257252 predicted 1183
7 SASI_Hs01_00257253 predicted 584
8 SASI_Hs01_00257254 predicted 955
9 SASI_Hs01_00257255 predicted 896
10 SASI_Hs01_00257256 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060852 predicted 630
2 SASI_Rn01_00060853 predicted 1319
3 SASI_Rn01_00060855 predicted 505
4 SASI_Rn01_00060856 predicted 728
5 SASI_Rn01_00060857 predicted 662
6 SASI_Rn01_00060858 predicted 976
7 SASI_Rn01_00060859 predicted 885
8 SASI_Rn02_00200322 predicted 1149
9 SASI_Rn01_00060860 predicted 1318
10 SASI_Rn01_00060861 predicted 515
11 SASI_Rn01_00060854 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137555 predicted 1136
2 SASI_Rn01_00137556 predicted 1330
3 SASI_Rn01_00137557 predicted 787
4 SASI_Rn01_00137558 predicted 861
5 SASI_Rn01_00137559 predicted 892
6 SASI_Rn01_00137560 predicted 812
7 SASI_Rn01_00137561 predicted 1394
8 SASI_Rn01_00137562 predicted 328
9 SASI_Rn01_00137563 predicted 1337
10 SASI_Rn01_00137564 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094483 predicted 551
2 SASI_Mm01_00094484 predicted 788
3 SASI_Mm01_00094485 predicted 1320
4 SASI_Mm01_00094486 predicted 1327
5 SASI_Mm01_00094487 predicted 589
6 SASI_Mm01_00094488 predicted 907
7 SASI_Mm01_00094489 predicted 889
8 SASI_Mm01_00094490 predicted 252
9 SASI_Mm02_00322266 predicted 329
10 SASI_Mm01_00094491 predicted 1110
11 SASI_Mm01_00094482 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013547
HGD MISSION shRNA Bacterial Glycerol Stock
homogentisate 1,2-dioxygenase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-729s21c1
Sequence:CCGGGATTCAGCGTCGATGTCTTTGCTCGAGCAAAGACATCGACGCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-597s1c2
Sequence:CCGGGCCCAATGAAATCTGCGTCATCTCGAGATGACGCAGATTTCATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-1151s21c1
Sequence:CCGGACCTTCAGACCTCCTTATTACCTCGAGGTAATAAGGAGGTCTGAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-891s21c1
Sequence:CCCGGTGGTTACACTGTGATTAATACTCGAGTATTAATCACAGTGTAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013547.2-1443s1c1
Sequence:CCGGCGTGCATAGCTTCCTTGAGATCTCGAGATCTCAAGGAAGCTATGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-745s1c1
Sequence:CCGGCGAGATTTCTTGATTCCCGTTCTCGAGAACGGGAATCAAGAAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-876s1c1
Sequence:CCGGGCATGGAAACTACACACCCTACTCGAGTAGGGTGTGTAGTTTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-559s1c1
Sequence:CCGGCTTCTCATTTACACCGAGTTTCTCGAGAAACTCGGTGTAAATGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013547
HGD MISSION shRNA shRNA Plasmid DNA
homogentisate 1,2-dioxygenase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-729s21c1
Sequence:CCGGGATTCAGCGTCGATGTCTTTGCTCGAGCAAAGACATCGACGCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-597s1c2
Sequence:CCGGGCCCAATGAAATCTGCGTCATCTCGAGATGACGCAGATTTCATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-1151s21c1
Sequence:CCGGACCTTCAGACCTCCTTATTACCTCGAGGTAATAAGGAGGTCTGAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-891s21c1
Sequence:CCCGGTGGTTACACTGTGATTAATACTCGAGTATTAATCACAGTGTAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013547.2-1443s1c1
Sequence:CCGGCGTGCATAGCTTCCTTGAGATCTCGAGATCTCAAGGAAGCTATGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-745s1c1
Sequence:CCGGCGAGATTTCTTGATTCCCGTTCTCGAGAACGGGAATCAAGAAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-876s1c1
Sequence:CCGGGCATGGAAACTACACACCCTACTCGAGTAGGGTGTGTAGTTTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-559s1c1
Sequence:CCGGCTTCTCATTTACACCGAGTTTCTCGAGAAACTCGGTGTAAATGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013547
HGD MISSION shRNA Lentiviral Transduction Particles
homogentisate 1,2-dioxygenase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-729s21c1
Sequence:CCGGGATTCAGCGTCGATGTCTTTGCTCGAGCAAAGACATCGACGCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-597s1c2
Sequence:CCGGGCCCAATGAAATCTGCGTCATCTCGAGATGACGCAGATTTCATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-1151s21c1
Sequence:CCGGACCTTCAGACCTCCTTATTACCTCGAGGTAATAAGGAGGTCTGAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013547.3-891s21c1
Sequence:CCCGGTGGTTACACTGTGATTAATACTCGAGTATTAATCACAGTGTAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013547.2-1443s1c1
Sequence:CCGGCGTGCATAGCTTCCTTGAGATCTCGAGATCTCAAGGAAGCTATGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-745s1c1
Sequence:CCGGCGAGATTTCTTGATTCCCGTTCTCGAGAACGGGAATCAAGAAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-876s1c1
Sequence:CCGGGCATGGAAACTACACACCCTACTCGAGTAGGGTGTGTAGTTTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013547.2-559s1c1
Sequence:CCGGCTTCTCATTTACACCGAGTTTCTCGAGAAACTCGGTGTAAATGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000187
VALIDATED
HGD MISSION shRNA Bacterial Glycerol Stock
homogentisate 1,2-dioxygenase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1764s21c1
Sequence:CCGGCTCATGCTTTCTGGTAGTATTCTCGAGAATACTACCAGAAAGCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1453s21c1
Sequence:CCGGAGGGAGTCTACACAGCACAATCTCGAGATTGTGCTGTGTAGACTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-521s21c1
Sequence:CCGGTGTCCACGGAGCACCAATAAGCTCGAGCTTATTGGTGCTCCGTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000187.2-1194s21c1
Sequence:CCGGACAAGTACAACCTGAAGAATTCTCGAGAATTCTTCAGGTTGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1089s21c1
Sequence:CCGGCAGGTGGTTACACGGTCATTACTCGAGTAATGACCGTGTAACCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-1563s1c1
Sequence:CCGGCTCATGCTTTCTGGTAGTATTCTCGAGAATACTACCAGAAAGCATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-840s1c1
Sequence:CCGGCGTGATTTCTTGATACCCATTCTCGAGAATGGGTATCAAGAAATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-991s1c1
Sequence:CCGGACAAGTACAACCTGAAGAATTCTCGAGAATTCTTCAGGTTGTACTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000187.x-1286s1c1
Sequence:CCGGTGATGCTGACTGCTTTGAGAACTCGAGTTCTCAAAGCAGTCAGCATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000187
VALIDATED
HGD MISSION shRNA shRNA Plasmid DNA
homogentisate 1,2-dioxygenase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1764s21c1
Sequence:CCGGCTCATGCTTTCTGGTAGTATTCTCGAGAATACTACCAGAAAGCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1453s21c1
Sequence:CCGGAGGGAGTCTACACAGCACAATCTCGAGATTGTGCTGTGTAGACTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-521s21c1
Sequence:CCGGTGTCCACGGAGCACCAATAAGCTCGAGCTTATTGGTGCTCCGTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000187.2-1194s21c1
Sequence:CCGGACAAGTACAACCTGAAGAATTCTCGAGAATTCTTCAGGTTGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1089s21c1
Sequence:CCGGCAGGTGGTTACACGGTCATTACTCGAGTAATGACCGTGTAACCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-1563s1c1
Sequence:CCGGCTCATGCTTTCTGGTAGTATTCTCGAGAATACTACCAGAAAGCATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-840s1c1
Sequence:CCGGCGTGATTTCTTGATACCCATTCTCGAGAATGGGTATCAAGAAATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-991s1c1
Sequence:CCGGACAAGTACAACCTGAAGAATTCTCGAGAATTCTTCAGGTTGTACTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000187.x-1286s1c1
Sequence:CCGGTGATGCTGACTGCTTTGAGAACTCGAGTTCTCAAAGCAGTCAGCATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000187
VALIDATED
HGD MISSION shRNA Lentiviral Transduction Particles
homogentisate 1,2-dioxygenase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1764s21c1
Sequence:CCGGCTCATGCTTTCTGGTAGTATTCTCGAGAATACTACCAGAAAGCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1453s21c1
Sequence:CCGGAGGGAGTCTACACAGCACAATCTCGAGATTGTGCTGTGTAGACTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-521s21c1
Sequence:CCGGTGTCCACGGAGCACCAATAAGCTCGAGCTTATTGGTGCTCCGTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000187.2-1194s21c1
Sequence:CCGGACAAGTACAACCTGAAGAATTCTCGAGAATTCTTCAGGTTGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000187.2-1089s21c1
Sequence:CCGGCAGGTGGTTACACGGTCATTACTCGAGTAATGACCGTGTAACCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-1563s1c1
Sequence:CCGGCTCATGCTTTCTGGTAGTATTCTCGAGAATACTACCAGAAAGCATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-840s1c1
Sequence:CCGGCGTGATTTCTTGATACCCATTCTCGAGAATGGGTATCAAGAAATCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000187.x-991s1c1
Sequence:CCGGACAAGTACAACCTGAAGAATTCTCGAGAATTCTTCAGGTTGTACTTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000187.x-1286s1c1
Sequence:CCGGTGATGCTGACTGCTTTGAGAACTCGAGTTCTCAAAGCAGTCAGCATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)