EMAIL THIS PAGE TO A FRIEND

HGF

hepatocyte growth factor (hepapoietin A; scatter factor)

130 Gene Product Result for
Synonyms: DFNB39 F-TCF HGFB HPTA SF
Gene ID:
Human(3082) Summary: Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor. Hepatocyte growth factor is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. It is secreted as a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. The protein belongs to the plasminogen subfamily of S1 peptidases but has no detectable protease activity. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(15234) hepatocyte growth factor
Rat(24446) hepatocyte growth factor
domestic guinea pig(100730730) hepatocyte growth factor (hepapoietin A; scatter factor)
naked mole-rat(101707056) hepatocyte growth factor (hepapoietin A; scatter factor)
sheep(443075) hepatocyte growth factor (hepapoietin A; scatter factor)
Domestic Rabbit(100316908) hepatocyte growth factor (hepapoietin A; scatter factor)
chicken(395941) hepatocyte growth factor (hepapoietin A; scatter factor)
cow(282879) hepatocyte growth factor (hepapoietin A; scatter factor)
domestic cat(493705) hepatocyte growth factor (hepapoietin A; scatter factor)
dog(403441) hepatocyte growth factor (hepapoietin A; scatter factor)
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H7157 Anti-Hepatocyte Growth Factor antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, western blot pricing
H0652 Anti-Hepatocyte Growth Factor antibody produced in goat IgG fraction of antiserum, lyophilized powder human
neutralization, western blot pricing
H0540 Anti-Hepatocyte Growth Factor antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, immunohistochemistry, western blot pricing
SAB2101033 Anti-HGF (ab1) antibody produced in rabbit affinity isolated antibody horse, guinea pig, bovine, mouse, rabbit, human, dog, rat
immunohistochemistry, western blot pricing
SAB2101034 Anti-HGF (ab2) antibody produced in rabbit affinity isolated antibody horse, pig, mouse, rabbit, rat, dog, sheep, bovine, human
immunohistochemistry, western blot pricing
SAB2105571 Anti-HGF antibody produced in rabbit affinity isolated antibody human, pig, bovine, rabbit, horse, dog, rat, mouse
western blot pricing
HPA040360 Anti-HGF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA044088 Anti-HGF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410624 Anti-HGF antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
proximity ligation assay, western blot pricing
H1896 Monoclonal Anti-Hepatocyte Growth Factor antibody produced in mouse clone 24612.111, purified immunoglobulin, lyophilized powder human
ELISA, neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000601 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB1431 Anti-Interferon-β Antibody This Anti-Interferon-β Antibody is validated for use in ELISA, IH, IP, NEUT, WB for the detection of Interferon-β. pricing
MAB416 Anti-Interferon-β Antibody, clone A1 Anti-Interferon-β Antibody, clone A1 detects level of Interferon-β & has been published & validated for use in ELISA & WB. pricing
AB1839 Anti-Interleukin-6 Antibody Anti-Interleukin-6 Antibody is an antibody against Interleukin-6 for use in ELISA & WB. pricing
MAB1004 Anti-Interleukin-6 Antibody, clone 4B6 This Anti-Interleukin-6 Antibody, clone 4B6 is validated for use in ELISA for the detection of Interleukin-6. pricing
CBL2117 Anti-Interleukin-6 Antibody, clone B-E8 Detect Interleukin-6 using this Anti-Interleukin-6 Antibody, clone B-E8 validated for use in ELISA, FC, IH, NEUT. pricing
MABF41 Anti-Interleukin-6 (IL-6) Antibody, clone 1G3 Anti-Interleukin-6 (IL-6) Antibody, clone 1G3 is an antibody against Interleukin-6 (IL-6) for use in WB. pricing
07-337 Anti-SOS1 Antibody, CT Anti-SOS1 Antibody, CT is an antibody against SOS1 for use in IP & WB. pricing
GF116 Hepatocyte Growth Factor Protein, Recombinant human The Human Hepatocyte Growth Factor (or HGF protein) is also known as Scatter Factor & Hepatopoeitin A. pricing
IL006 Interleukin-6 Protein, Recombinant human The recombinant human Interleukin-6 protein (or IL-6 protein) is a potent lymphoid cell growth factor which affects B-lymphocytes, T-lymphocytes & hybridoma cells. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000601 Rosetta Predictions human pricing
NM_001010931 Rosetta Predictions human pricing
NM_001010932 Rosetta Predictions human pricing
NM_001010933 Rosetta Predictions human pricing
NM_001010934 Rosetta Predictions human pricing
NM_017017 Rosetta Predictions rat pricing
NM_010427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117198 predicted 266
2 SASI_Hs01_00117199 predicted 398
3 SASI_Hs01_00117201 predicted 270
4 SASI_Hs02_00302888 predicted 320
5 SASI_Hs01_00117202 predicted 292
6 SASI_Hs01_00117203 predicted 302
7 SASI_Hs01_00117204 predicted 404
8 SASI_Hs01_00117205 predicted 390
9 SASI_Hs01_00117206 predicted 346
10 SASI_Hs01_00117207 predicted 366
11 SASI_Hs01_00117200 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234946 predicted 268
2 SASI_Hs01_00234947 predicted 404
3 SASI_Hs01_00234949 predicted 265
4 SASI_Hs02_00305923 predicted 321
5 SASI_Hs01_00234950 predicted 297
6 SASI_Hs01_00234951 predicted 295
7 SASI_Hs01_00234952 predicted 397
8 SASI_Hs01_00234953 predicted 391
9 SASI_Hs01_00234954 predicted 347
10 SASI_Hs01_00234955 predicted 362
11 SASI_Hs01_00234948 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165278 predicted 269
2 SASI_Hs02_00305924 predicted 406
3 SASI_Hs01_00165280 predicted 265
4 SASI_Hs02_00305925 predicted 319
5 SASI_Hs01_00165281 predicted 293
6 SASI_Hs01_00165282 predicted 294
7 SASI_Hs01_00165283 predicted 398
8 SASI_Hs01_00165284 predicted 389
9 SASI_Hs01_00165285 predicted 346
10 SASI_Hs01_00165286 predicted 362
11 SASI_Hs01_00165279 predicted 375
12 SASI_Hs01_00165287 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199774 predicted 267
2 SASI_Hs01_00199775 predicted 401
3 SASI_Hs01_00199777 predicted 273
4 SASI_Hs02_00305926 predicted 323
5 SASI_Hs01_00199778 predicted 295
6 SASI_Hs01_00199779 predicted 293
7 SASI_Hs01_00199780 predicted 401
8 SASI_Hs01_00199781 predicted 382
9 SASI_Hs01_00199782 predicted 349
10 SASI_Hs01_00199783 predicted 363
11 SASI_Hs01_00199776 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187496 predicted 272
2 SASI_Hs01_00187497 predicted 400
3 SASI_Hs01_00187499 predicted 266
4 SASI_Hs02_00305927 predicted 318
5 SASI_Hs01_00187500 predicted 298
6 SASI_Hs01_00187501 predicted 296
7 SASI_Hs01_00187502 predicted 400
8 SASI_Hs01_00187503 predicted 389
9 SASI_Hs01_00187504 predicted 349
10 SASI_Hs01_00187505 predicted 364
11 SASI_Hs01_00187498 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114679 predicted 515
2 SASI_Rn02_00261184 predicted 1039
3 SASI_Rn01_00114681 predicted 424
4 SASI_Rn01_00114682 predicted 431
5 SASI_Rn01_00114683 predicted 868
6 SASI_Rn01_00114684 predicted 365
7 SASI_Rn01_00114685 predicted 1405
8 SASI_Rn02_00261185 predicted 1947
9 SASI_Rn01_00114686 predicted 1855
10 SASI_Rn01_00114687 predicted 2014
11 SASI_Rn01_00114680 predicted 1934
12 SASI_Rn01_00114688 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318578 predicted 2079
2 SASI_Mm01_00197724 predicted 409
3 SASI_Mm01_00197725 predicted 498
4 SASI_Mm01_00197726 predicted 512
5 SASI_Mm01_00197727 predicted 1988
6 SASI_Mm01_00197729 predicted 2136
7 SASI_Mm02_00318579 predicted 1195
8 SASI_Mm01_00197731 predicted 1923
9 SASI_Mm01_00197732 predicted 542
10 SASI_Mm02_00318580 predicted 2062
11 SASI_Mm01_00197728 predicted 1390
12 SASI_Mm01_00197730 predicted 2226
13 SASI_Mm01_00197733 predicted 1921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000601
HGF MISSION shRNA Bacterial Glycerol Stock
hepatocyte growth factor (hepapoietin A; scatter factor)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-822s21c1
Sequence:CCGGTCGAGGTCTCATGGATCATACCTCGAGGTATGATCCATGAGACCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-1577s21c1
Sequence:CCGGGTGATACCACACCTACAATAGCTCGAGCTATTGTAGGTGTGGTATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-265s1c1
Sequence:CCGGCAGACCAATGTGCTAATAGATCTCGAGATCTATTAGCACATTGGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.3-1512s2c1
Sequence:CCGGCCCGTAATATCTTGTGCCAAACTCGAGTTTGGCACAAGATATTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000601.3-2265s2c1
Sequence:CCGGTGTCTGAAGCACCCACCAATACTCGAGTATTGGTGGGTGCTTCAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000601.3-1359s2c1
Sequence:CCGGGCAAGTAAGCTGAATGAGAATCTCGAGATTCTCATTCAGCTTACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.3-201s2c1
Sequence:CCGGGCAAAGACTACCCTAATCAAACTCGAGTTTGATTAGGGTAGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000601.x-2265s1c1
Sequence:CCGGTGTCTGAAGCACCCACCAATACTCGAGTATTGGTGGGTGCTTCAGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-2281s21c1
Sequence:CCGGTTTGTCCGAGTAGCATATTATCTCGAGATAATATGCTACTCGGACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-201s1c1
Sequence:CCGGGCAAAGACTACCCTAATCAAACTCGAGTTTGATTAGGGTAGTCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-1359s1c1
Sequence:CCGGGCAAGTAAGCTGAATGAGAATCTCGAGATTCTCATTCAGCTTACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-1512s1c1
Sequence:CCGGCCCGTAATATCTTGTGCCAAACTCGAGTTTGGCACAAGATATTACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000601
HGF MISSION shRNA shRNA Plasmid DNA
hepatocyte growth factor (hepapoietin A; scatter factor)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-822s21c1
Sequence:CCGGTCGAGGTCTCATGGATCATACCTCGAGGTATGATCCATGAGACCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-1577s21c1
Sequence:CCGGGTGATACCACACCTACAATAGCTCGAGCTATTGTAGGTGTGGTATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-265s1c1
Sequence:CCGGCAGACCAATGTGCTAATAGATCTCGAGATCTATTAGCACATTGGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.3-1512s2c1
Sequence:CCGGCCCGTAATATCTTGTGCCAAACTCGAGTTTGGCACAAGATATTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000601.3-2265s2c1
Sequence:CCGGTGTCTGAAGCACCCACCAATACTCGAGTATTGGTGGGTGCTTCAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000601.3-1359s2c1
Sequence:CCGGGCAAGTAAGCTGAATGAGAATCTCGAGATTCTCATTCAGCTTACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.3-201s2c1
Sequence:CCGGGCAAAGACTACCCTAATCAAACTCGAGTTTGATTAGGGTAGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000601.x-2265s1c1
Sequence:CCGGTGTCTGAAGCACCCACCAATACTCGAGTATTGGTGGGTGCTTCAGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-2281s21c1
Sequence:CCGGTTTGTCCGAGTAGCATATTATCTCGAGATAATATGCTACTCGGACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-201s1c1
Sequence:CCGGGCAAAGACTACCCTAATCAAACTCGAGTTTGATTAGGGTAGTCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-1359s1c1
Sequence:CCGGGCAAGTAAGCTGAATGAGAATCTCGAGATTCTCATTCAGCTTACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-1512s1c1
Sequence:CCGGCCCGTAATATCTTGTGCCAAACTCGAGTTTGGCACAAGATATTACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000601
HGF MISSION shRNA Lentiviral Transduction Particles
hepatocyte growth factor (hepapoietin A; scatter factor)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-822s21c1
Sequence:CCGGTCGAGGTCTCATGGATCATACCTCGAGGTATGATCCATGAGACCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-1577s21c1
Sequence:CCGGGTGATACCACACCTACAATAGCTCGAGCTATTGTAGGTGTGGTATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-265s1c1
Sequence:CCGGCAGACCAATGTGCTAATAGATCTCGAGATCTATTAGCACATTGGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.3-1512s2c1
Sequence:CCGGCCCGTAATATCTTGTGCCAAACTCGAGTTTGGCACAAGATATTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000601.3-2265s2c1
Sequence:CCGGTGTCTGAAGCACCCACCAATACTCGAGTATTGGTGGGTGCTTCAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_000601.3-1359s2c1
Sequence:CCGGGCAAGTAAGCTGAATGAGAATCTCGAGATTCTCATTCAGCTTACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.3-201s2c1
Sequence:CCGGGCAAAGACTACCCTAATCAAACTCGAGTTTGATTAGGGTAGTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000601.x-2265s1c1
Sequence:CCGGTGTCTGAAGCACCCACCAATACTCGAGTATTGGTGGGTGCTTCAGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000601.4-2281s21c1
Sequence:CCGGTTTGTCCGAGTAGCATATTATCTCGAGATAATATGCTACTCGGACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-201s1c1
Sequence:CCGGGCAAAGACTACCCTAATCAAACTCGAGTTTGATTAGGGTAGTCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-1359s1c1
Sequence:CCGGGCAAGTAAGCTGAATGAGAATCTCGAGATTCTCATTCAGCTTACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000601.x-1512s1c1
Sequence:CCGGCCCGTAATATCTTGTGCCAAACTCGAGTTTGGCACAAGATATTACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010427
VALIDATED
HGF MISSION shRNA Bacterial Glycerol Stock
hepatocyte growth factor (hepapoietin A; scatter factor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-616s21c1
Sequence:CCGGCTTCGAGCTATCGCGGTAAAGCTCGAGCTTTACCGCGATAGCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010427.4-516s21c1
Sequence:CCGGGGTAAAGGAGGCAGCTATAAACTCGAGTTTATAGCTGCCTCCTTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010427.4-2513s21c1
Sequence:CCGGCCTGCAAGTGCAGTAACATATCTCGAGATATGTTACTGCACTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-1505s21c1
Sequence:CCGGTTGGGATTATTGCCCTATTTCCTCGAGGAAATAGGGCAATAATCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010427.2-2537s1c1
Sequence:CCGGCCTGAAGATACTTGAATGAATCTCGAGATTCATTCAAGTATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-527s1c1
Sequence:CCGGGCAGCTATAAAGGGACGGTATCTCGAGATACCGTCCCTTTATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-1738s1c1
Sequence:CCGGGCCAGAAACAAAGACTTGAAACTCGAGTTTCAAGTCTTTGTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-2225s1c1
Sequence:CCGGCCATCCCAAATCGTCCTGTTACTCGAGTAACAGGACGATTTGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-685s1c1
Sequence:CCGGCCCTGGTGTTTCACAAGCAATCTCGAGATTGCTTGTGAAACACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-1808s21c1
Sequence:CCGGGAAGCGCAAGCAGATCTTAAACTCGAGTTTAAGATCTGCTTGCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010427
VALIDATED
HGF MISSION shRNA shRNA Plasmid DNA
hepatocyte growth factor (hepapoietin A; scatter factor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-616s21c1
Sequence:CCGGCTTCGAGCTATCGCGGTAAAGCTCGAGCTTTACCGCGATAGCTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010427.4-516s21c1
Sequence:CCGGGGTAAAGGAGGCAGCTATAAACTCGAGTTTATAGCTGCCTCCTTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010427.4-2513s21c1
Sequence:CCGGCCTGCAAGTGCAGTAACATATCTCGAGATATGTTACTGCACTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-1505s21c1
Sequence:CCGGTTGGGATTATTGCCCTATTTCCTCGAGGAAATAGGGCAATAATCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010427.2-2537s1c1
Sequence:CCGGCCTGAAGATACTTGAATGAATCTCGAGATTCATTCAAGTATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-527s1c1
Sequence:CCGGGCAGCTATAAAGGGACGGTATCTCGAGATACCGTCCCTTTATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-1738s1c1
Sequence:CCGGGCCAGAAACAAAGACTTGAAACTCGAGTTTCAAGTCTTTGTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-2225s1c1
Sequence:CCGGCCATCCCAAATCGTCCTGTTACTCGAGTAACAGGACGATTTGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-685s1c1
Sequence:CCGGCCCTGGTGTTTCACAAGCAATCTCGAGATTGCTTGTGAAACACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-1808s21c1
Sequence:CCGGGAAGCGCAAGCAGATCTTAAACTCGAGTTTAAGATCTGCTTGCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010427
VALIDATED
HGF MISSION shRNA Lentiviral Transduction Particles
hepatocyte growth factor (hepapoietin A; scatter factor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-616s21c1
Sequence:CCGGCTTCGAGCTATCGCGGTAAAGCTCGAGCTTTACCGCGATAGCTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010427.4-516s21c1
Sequence:CCGGGGTAAAGGAGGCAGCTATAAACTCGAGTTTATAGCTGCCTCCTTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010427.4-2513s21c1
Sequence:CCGGCCTGCAAGTGCAGTAACATATCTCGAGATATGTTACTGCACTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-1505s21c1
Sequence:CCGGTTGGGATTATTGCCCTATTTCCTCGAGGAAATAGGGCAATAATCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010427.2-2537s1c1
Sequence:CCGGCCTGAAGATACTTGAATGAATCTCGAGATTCATTCAAGTATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-527s1c1
Sequence:CCGGGCAGCTATAAAGGGACGGTATCTCGAGATACCGTCCCTTTATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-1738s1c1
Sequence:CCGGGCCAGAAACAAAGACTTGAAACTCGAGTTTCAAGTCTTTGTTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-2225s1c1
Sequence:CCGGCCATCCCAAATCGTCCTGTTACTCGAGTAACAGGACGATTTGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010427.2-685s1c1
Sequence:CCGGCCCTGGTGTTTCACAAGCAATCTCGAGATTGCTTGTGAAACACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010427.4-1808s21c1
Sequence:CCGGGAAGCGCAAGCAGATCTTAAACTCGAGTTTAAGATCTGCTTGCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)