EMAIL THIS PAGE TO A FRIEND

HGFAC

HGF activator

57 Gene Product Result for
Synonyms: HGFA
UniProtKB ID: Q04756, Q14726, Q2M1W7, Q53X47
Gene ID:
Human(3083) Summary: The protein encoded by this gene belongs to peptidase family S1. It is first synthesized as an inactive single-chain precursor before being activated to a heterodimeric form by endoproteolytic processing. It acts as serine protease that converts hepatocyte growth factor to the active form. [provided by RefSeq, Jul 2008]
Mouse(54426) hepatocyte growth factor activator
Rat(58947) HGF activator
chicken(422876) HGF activator
cow(100139648) HGF activator
domestic cat(101087227) HGF activator
dog(403432) HGF activator
sheep(101121424) HGF activator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005551 MISSION® esiRNA esiRNA targeting human HGFAC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001528 Rosetta Predictions human pricing
NM_053320 Rosetta Predictions rat pricing
NM_019447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195916 predicted 1418
2 SASI_Hs01_00195917 predicted 601
3 SASI_Hs01_00195918 predicted 1447
4 SASI_Hs01_00195919 predicted 1200
5 SASI_Hs01_00195920 predicted 1007
6 SASI_Hs01_00195921 predicted 1108
7 SASI_Hs02_00332062 predicted 842
8 SASI_Hs01_00195922 predicted 1104
9 SASI_Hs01_00195923 predicted 1386
10 SASI_Hs01_00195924 predicted 719
11 SASI_Hs01_00195925 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076812 predicted 1630
2 SASI_Rn01_00076813 predicted 1422
3 SASI_Rn01_00076815 predicted 853
4 SASI_Rn02_00265746 predicted 1377
5 SASI_Rn02_00265747 predicted 592
6 SASI_Rn01_00076816 predicted 606
7 SASI_Rn02_00265748 predicted 1625
8 SASI_Rn01_00076817 predicted 754
9 SASI_Rn01_00076818 predicted 1037
10 SASI_Rn01_00076819 predicted 1454
11 SASI_Rn01_00076814 predicted 1461
12 SASI_Rn01_00076820 predicted 367
13 SASI_Rn01_00076821 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324427 predicted 1525
2 SASI_Mm02_00324428 predicted 629
3 SASI_Mm02_00324429 predicted 1456
4 SASI_Mm02_00324430 predicted 550
5 SASI_Mm02_00324431 predicted 627
6 SASI_Mm02_00324432 predicted 644
7 SASI_Mm02_00324433 predicted 1320
8 SASI_Mm02_00324434 predicted 856
9 SASI_Mm02_00324435 predicted 635
10 SASI_Mm01_00155252 predicted 798
11 SASI_Mm01_00155243 predicted 1064
12 SASI_Mm01_00155244 predicted 398
13 SASI_Mm01_00155245 predicted 999
14 SASI_Mm01_00155246 predicted 1416
15 SASI_Mm01_00155247 predicted 1450
16 SASI_Mm01_00155248 predicted 1183
17 SASI_Mm01_00155249 predicted 461
18 SASI_Mm01_00155250 predicted 1691
19 SASI_Mm01_00155251 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001528
HGFAC MISSION shRNA Bacterial Glycerol Stock
HGF activator
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001528.2-172s21c1
Sequence:CCGGACTATCCTGGTGACCTCTGTGCTCGAGCACAGAGGTCACCAGGATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001528.2-835s21c1
Sequence:CCGGTGCAACATCGAGCCTGATGAGCTCGAGCTCATCAGGCTCGATGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-592s1c1
Sequence:CCGGTGCGGCACAGAGAAATGCTTTCTCGAGAAAGCATTTCTCTGTGCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-722s1c1
Sequence:CCGGCCCGACATACAGCTTGTCTGACTCGAGTCAGACAAGCTGTATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-399s1c1
Sequence:CCGGGTGTGCCACAACTCACAACTACTCGAGTAGTTGTGAGTTGTGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-1431s1c1
Sequence:CCGGCTTCGGCATCGAGAAGTACATCTCGAGATGTACTTCTCGATGCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-1827s1c1
Sequence:CCGGCGTGGCTTACCTCTACGGCATCTCGAGATGCCGTAGAGGTAAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001528
HGFAC MISSION shRNA shRNA Plasmid DNA
HGF activator
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001528.2-172s21c1
Sequence:CCGGACTATCCTGGTGACCTCTGTGCTCGAGCACAGAGGTCACCAGGATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001528.2-835s21c1
Sequence:CCGGTGCAACATCGAGCCTGATGAGCTCGAGCTCATCAGGCTCGATGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-592s1c1
Sequence:CCGGTGCGGCACAGAGAAATGCTTTCTCGAGAAAGCATTTCTCTGTGCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-722s1c1
Sequence:CCGGCCCGACATACAGCTTGTCTGACTCGAGTCAGACAAGCTGTATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-399s1c1
Sequence:CCGGGTGTGCCACAACTCACAACTACTCGAGTAGTTGTGAGTTGTGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-1431s1c1
Sequence:CCGGCTTCGGCATCGAGAAGTACATCTCGAGATGTACTTCTCGATGCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-1827s1c1
Sequence:CCGGCGTGGCTTACCTCTACGGCATCTCGAGATGCCGTAGAGGTAAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001528
HGFAC MISSION shRNA Lentiviral Transduction Particles
HGF activator
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001528.2-172s21c1
Sequence:CCGGACTATCCTGGTGACCTCTGTGCTCGAGCACAGAGGTCACCAGGATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001528.2-835s21c1
Sequence:CCGGTGCAACATCGAGCCTGATGAGCTCGAGCTCATCAGGCTCGATGTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-592s1c1
Sequence:CCGGTGCGGCACAGAGAAATGCTTTCTCGAGAAAGCATTTCTCTGTGCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-722s1c1
Sequence:CCGGCCCGACATACAGCTTGTCTGACTCGAGTCAGACAAGCTGTATGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-399s1c1
Sequence:CCGGGTGTGCCACAACTCACAACTACTCGAGTAGTTGTGAGTTGTGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-1431s1c1
Sequence:CCGGCTTCGGCATCGAGAAGTACATCTCGAGATGTACTTCTCGATGCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001528.2-1827s1c1
Sequence:CCGGCGTGGCTTACCTCTACGGCATCTCGAGATGCCGTAGAGGTAAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019447
VALIDATED
HGFAC MISSION shRNA Bacterial Glycerol Stock
HGF activator
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1305s21c1
Sequence:CCGGGCTGCCATCTACATTGGGAATCTCGAGATTCCCAATGTAGATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1930s21c1
Sequence:CCGGACACCCGTGTGGCCAATTATGCTCGAGCATAATTGGCCACACGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019447.2-431s21c1
Sequence:CCGGGTGCGCTACAACACACAACTACTCGAGTAGTTGTGTGTTGTAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1229s21c1
Sequence:CCGGGCACAAGAAGAGGACGTTCTTCTCGAGAAGAACGTCCTCTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-646s21c1
Sequence:CCGGATGAAACACGCTATGAGTATTCTCGAGAATACTCATAGCGTGTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-856s1c1
Sequence:CCGGCCTGGGAAATGGTACAGAGTACTCGAGTACTCTGTACCATTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-391s1c1
Sequence:CCGGGTGCGCTACAACACACAACTACTCGAGTAGTTGTGTGTTGTAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1189s1c1
Sequence:CCGGGCACAAGAAGAGGACGTTCTTCTCGAGAAGAACGTCCTCTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1913s1c1
Sequence:CCGGGACTGGATCAACGACCGTATTCTCGAGAATACGGTCGTTGATCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1265s1c1
Sequence:CCGGGCTGCCATCTACATTGGGAATCTCGAGATTCCCAATGTAGATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019447
VALIDATED
HGFAC MISSION shRNA shRNA Plasmid DNA
HGF activator
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1305s21c1
Sequence:CCGGGCTGCCATCTACATTGGGAATCTCGAGATTCCCAATGTAGATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1930s21c1
Sequence:CCGGACACCCGTGTGGCCAATTATGCTCGAGCATAATTGGCCACACGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019447.2-431s21c1
Sequence:CCGGGTGCGCTACAACACACAACTACTCGAGTAGTTGTGTGTTGTAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1229s21c1
Sequence:CCGGGCACAAGAAGAGGACGTTCTTCTCGAGAAGAACGTCCTCTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-646s21c1
Sequence:CCGGATGAAACACGCTATGAGTATTCTCGAGAATACTCATAGCGTGTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-856s1c1
Sequence:CCGGCCTGGGAAATGGTACAGAGTACTCGAGTACTCTGTACCATTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-391s1c1
Sequence:CCGGGTGCGCTACAACACACAACTACTCGAGTAGTTGTGTGTTGTAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1189s1c1
Sequence:CCGGGCACAAGAAGAGGACGTTCTTCTCGAGAAGAACGTCCTCTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1913s1c1
Sequence:CCGGGACTGGATCAACGACCGTATTCTCGAGAATACGGTCGTTGATCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1265s1c1
Sequence:CCGGGCTGCCATCTACATTGGGAATCTCGAGATTCCCAATGTAGATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019447
VALIDATED
HGFAC MISSION shRNA Lentiviral Transduction Particles
HGF activator
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1305s21c1
Sequence:CCGGGCTGCCATCTACATTGGGAATCTCGAGATTCCCAATGTAGATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1930s21c1
Sequence:CCGGACACCCGTGTGGCCAATTATGCTCGAGCATAATTGGCCACACGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019447.2-431s21c1
Sequence:CCGGGTGCGCTACAACACACAACTACTCGAGTAGTTGTGTGTTGTAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-1229s21c1
Sequence:CCGGGCACAAGAAGAGGACGTTCTTCTCGAGAAGAACGTCCTCTTCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019447.2-646s21c1
Sequence:CCGGATGAAACACGCTATGAGTATTCTCGAGAATACTCATAGCGTGTTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-856s1c1
Sequence:CCGGCCTGGGAAATGGTACAGAGTACTCGAGTACTCTGTACCATTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-391s1c1
Sequence:CCGGGTGCGCTACAACACACAACTACTCGAGTAGTTGTGTGTTGTAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1189s1c1
Sequence:CCGGGCACAAGAAGAGGACGTTCTTCTCGAGAAGAACGTCCTCTTCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1913s1c1
Sequence:CCGGGACTGGATCAACGACCGTATTCTCGAGAATACGGTCGTTGATCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019447.1-1265s1c1
Sequence:CCGGGCTGCCATCTACATTGGGAATCTCGAGATTCCCAATGTAGATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)