EMAIL THIS PAGE TO A FRIEND

HGS

hepatocyte growth factor-regulated tyrosine kinase substrate

61 Gene Product Result for
Synonyms: HRS
UniProtKB ID: O14964, Q9NR36
Gene ID:
Human(9146) Summary: The protein encoded by this gene regulates endosomal sorting and plays a critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, Dec 2010]
Mouse(15239) HGF-regulated tyrosine kinase substrate
Rat(56084) hepatocyte growth factor-regulated tyrosine kinase substrate
Zebrafish(334175) hepatocyte growth factor-regulated tyrosine kinase substrate
chicken(428675) hepatocyte growth factor-regulated tyrosine kinase substrate
dog(483367) hepatocyte growth factor-regulated tyrosine kinase substrate
domestic cat(101088702) hepatocyte growth factor-regulated tyrosine kinase substrate
cow(511582) hepatocyte growth factor-regulated tyrosine kinase substrate
domestic guinea pig(100732540) hepatocyte growth factor-regulated tyrosine kinase substrate
naked mole-rat(101706323) hepatocyte growth factor-regulated tyrosine kinase substrate
sheep(101116491) hepatocyte growth factor-regulated tyrosine kinase substrate
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004872 Anti-HGS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA007728 Anti-HGS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503561 Anti-HGS antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503560 Anti-HRS antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2500518 Anti-HRS/HGS antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, canine, mouse
ELISA, immunohistochemistry pricing
SAB4504231 Anti-phospho-HRS (pTyr334) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0009146M1 Monoclonal Anti-HGS antibody produced in mouse clone 6D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4100570 Monoclonal Anti-HGS antibody produced in mouse clone HGS-A539, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074591 MISSION® esiRNA esiRNA human HGS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004712 Rosetta Predictions human pricing
NM_019387 Rosetta Predictions rat pricing
NM_008244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187466 predicted 630
2 SASI_Hs01_00187468 predicted 487
3 SASI_Hs01_00187469 predicted 376
4 SASI_Hs02_00338173 predicted 1205
5 SASI_Hs01_00187470 predicted 1962
6 SASI_Hs01_00187471 predicted 1323
7 SASI_Hs01_00187472 predicted 1331
8 SASI_Hs01_00187473 predicted 1028
9 SASI_Hs01_00187475 predicted 287
10 SASI_Hs02_00338174 predicted 521
11 SASI_Hs01_00187467 predicted 720
12 SASI_Hs01_00187474 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083391 predicted 2295
2 SASI_Rn01_00083392 predicted 2109
3 SASI_Rn01_00083393 predicted 404
4 SASI_Rn01_00083394 predicted 1524
5 SASI_Rn01_00083395 predicted 655
6 SASI_Rn01_00083396 predicted 325
7 SASI_Rn01_00083397 predicted 2392
8 SASI_Rn01_00083398 predicted 1267
9 SASI_Rn01_00083399 predicted 369
10 SASI_Rn01_00083400 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155577 predicted 483
2 SASI_Mm01_00155578 predicted 2392
3 SASI_Mm01_00155579 predicted 421
4 SASI_Mm01_00155580 predicted 2401
5 SASI_Mm01_00155581 predicted 1257
6 SASI_Mm01_00155582 predicted 2147
7 SASI_Mm01_00155583 predicted 672
8 SASI_Mm01_00155584 predicted 349
9 SASI_Mm01_00155585 predicted 2408
10 SASI_Mm01_00155586 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004712
VALIDATED
HGS MISSION shRNA Bacterial Glycerol Stock
hepatocyte growth factor-regulated tyrosine kinase substrate
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004712.3-2680s21c1
Sequence:GTACCGGTCTGTGAGAGGTGGCAGGAATCTCGAGATTCCTGCCACCTCTCACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-386s21c1
Sequence:CCGGCGTCCGTAACAAGATCCTGTACTCGAGTACAGGATCTTGTTACGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-995s21c1
Sequence:CCGGCCTGTACTCTTCACCTGTGAACTCGAGTTCACAGGTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-494s21c1
Sequence:CCGGGCACGTCTTTCCAGAATTCAACTCGAGTTGAATTCTGGAAAGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-142s21c1
Sequence:GTACCGGAGACAGATTGGGAGTCCATTTCTCGAGAAATGGACTCCCAATCTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-494s1c1
Sequence:CCGGGCACGTCTTTCCAGAATTCAACTCGAGTTGAATTCTGGAAAGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-2423s21c1
Sequence:GTACCGGCTCACGTCCGGAGTAACACTACTCGAGTAGTGTTACTCCGGACGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-1340s1c1
Sequence:CCGGCCGCATGAAGAGTAACCACATCTCGAGATGTGGTTACTCTTCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-386s1c1
Sequence:CCGGCGTCCGTAACAAGATCCTGTACTCGAGTACAGGATCTTGTTACGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-1340s21c1
Sequence:CCGGCCGCATGAAGAGTAACCACATCTCGAGATGTGGTTACTCTTCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-995s1c1
Sequence:CCGGCCTGTACTCTTCACCTGTGAACTCGAGTTCACAGGTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-1058s21c1
Sequence:GTACCGGACGGTATCTCAACCGGAACTACTCGAGTAGTTCCGGTTGAGATACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004712.3-2456s21c1
Sequence:GTACCGGCTGAAACGCCTCGTCTCTAACCTCGAGGTTAGAGACGAGGCGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-1252s21c1
Sequence:GTACCGGGTGAGCCACAGTTCCACAATGCTCGAGCATTGTGGAACTGTGGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004712
VALIDATED
HGS MISSION shRNA shRNA Plasmid DNA
hepatocyte growth factor-regulated tyrosine kinase substrate
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004712.3-2680s21c1
Sequence:GTACCGGTCTGTGAGAGGTGGCAGGAATCTCGAGATTCCTGCCACCTCTCACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-386s21c1
Sequence:CCGGCGTCCGTAACAAGATCCTGTACTCGAGTACAGGATCTTGTTACGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-995s21c1
Sequence:CCGGCCTGTACTCTTCACCTGTGAACTCGAGTTCACAGGTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-494s21c1
Sequence:CCGGGCACGTCTTTCCAGAATTCAACTCGAGTTGAATTCTGGAAAGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-142s21c1
Sequence:GTACCGGAGACAGATTGGGAGTCCATTTCTCGAGAAATGGACTCCCAATCTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-494s1c1
Sequence:CCGGGCACGTCTTTCCAGAATTCAACTCGAGTTGAATTCTGGAAAGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-2423s21c1
Sequence:GTACCGGCTCACGTCCGGAGTAACACTACTCGAGTAGTGTTACTCCGGACGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-1340s1c1
Sequence:CCGGCCGCATGAAGAGTAACCACATCTCGAGATGTGGTTACTCTTCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-386s1c1
Sequence:CCGGCGTCCGTAACAAGATCCTGTACTCGAGTACAGGATCTTGTTACGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-1340s21c1
Sequence:CCGGCCGCATGAAGAGTAACCACATCTCGAGATGTGGTTACTCTTCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-995s1c1
Sequence:CCGGCCTGTACTCTTCACCTGTGAACTCGAGTTCACAGGTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-1058s21c1
Sequence:GTACCGGACGGTATCTCAACCGGAACTACTCGAGTAGTTCCGGTTGAGATACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004712.3-2456s21c1
Sequence:GTACCGGCTGAAACGCCTCGTCTCTAACCTCGAGGTTAGAGACGAGGCGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-1252s21c1
Sequence:GTACCGGGTGAGCCACAGTTCCACAATGCTCGAGCATTGTGGAACTGTGGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004712
VALIDATED
HGS MISSION shRNA Lentiviral Transduction Particles
hepatocyte growth factor-regulated tyrosine kinase substrate
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004712.3-2680s21c1
Sequence:GTACCGGTCTGTGAGAGGTGGCAGGAATCTCGAGATTCCTGCCACCTCTCACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-386s21c1
Sequence:CCGGCGTCCGTAACAAGATCCTGTACTCGAGTACAGGATCTTGTTACGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-995s21c1
Sequence:CCGGCCTGTACTCTTCACCTGTGAACTCGAGTTCACAGGTGAAGAGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-494s21c1
Sequence:CCGGGCACGTCTTTCCAGAATTCAACTCGAGTTGAATTCTGGAAAGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-142s21c1
Sequence:GTACCGGAGACAGATTGGGAGTCCATTTCTCGAGAAATGGACTCCCAATCTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-494s1c1
Sequence:CCGGGCACGTCTTTCCAGAATTCAACTCGAGTTGAATTCTGGAAAGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-2423s21c1
Sequence:GTACCGGCTCACGTCCGGAGTAACACTACTCGAGTAGTGTTACTCCGGACGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-1340s1c1
Sequence:CCGGCCGCATGAAGAGTAACCACATCTCGAGATGTGGTTACTCTTCATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-386s1c1
Sequence:CCGGCGTCCGTAACAAGATCCTGTACTCGAGTACAGGATCTTGTTACGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-1340s21c1
Sequence:CCGGCCGCATGAAGAGTAACCACATCTCGAGATGTGGTTACTCTTCATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004712.3-995s1c1
Sequence:CCGGCCTGTACTCTTCACCTGTGAACTCGAGTTCACAGGTGAAGAGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004712.3-1058s21c1
Sequence:GTACCGGACGGTATCTCAACCGGAACTACTCGAGTAGTTCCGGTTGAGATACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004712.3-2456s21c1
Sequence:GTACCGGCTGAAACGCCTCGTCTCTAACCTCGAGGTTAGAGACGAGGCGTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004712.3-1252s21c1
Sequence:GTACCGGGTGAGCCACAGTTCCACAATGCTCGAGCATTGTGGAACTGTGGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008244
VALIDATED
HGS MISSION shRNA Bacterial Glycerol Stock
hepatocyte growth factor-regulated tyrosine kinase substrate
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-235s21c1
Sequence:CCGGCCATCAAGAAGAAGGTTAATGCTCGAGCATTAACCTTCTTCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-331s21c1
Sequence:CCGGATGATGAAGTGGCCAACAAACCTCGAGGTTTGTTGGCCACTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-508s21c1
Sequence:CCGGGACATGTCTTCCCTGAATTTACTCGAGTAAATTCAGGGAAGACATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-2198s21c1
Sequence:CCGGGGGCTACCAGCCGTACAATATCTCGAGATATTGTACGGCTGGTAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-463s1c1
Sequence:CCGGCCTGAATTTAAGGAAAGTGATCTCGAGATCACTTTCCTTAAATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-2148s1c1
Sequence:CCGGCCAGCCGTACAATATGCAGAACTCGAGTTCTGCATATTGTACGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-2151s1c1
Sequence:CCGGGCCGTACAATATGCAGAATCTCTCGAGAGATTCTGCATATTGTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-1204s1c1
Sequence:CCGGCCCTTTAGTGAGTACCAGAATCTCGAGATTCTGGTACTCACTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008244.2-2675s1c1
Sequence:CCGGCCGGAGTCTGATGTGAACTAACTCGAGTTAGTTCACATCAGACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-382s21c1
Sequence:GTACCGGAGAGGCAAGTGGAAGTTAATGCTCGAGCATTAACTTCCACTTGCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-291s21c1
Sequence:GTACCGGGTGATGGAGTCTGTGGTAAAGCTCGAGCTTTACCACAGACTCCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-2731s21c1
Sequence:CCGGCCGGAGTCTGATGTGAACTAACTCGAGTTAGTTCACATCAGACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-1261s21c1
Sequence:GTACCGGCCTTTAGTGAGTACCAGAATGCTCGAGCATTCTGGTACTCACTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-539s21c1
Sequence:GTACCGGTGCCATGTTCGCTGCTGAAAGCTCGAGCTTTCAGCAGCGAACATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008244
VALIDATED
HGS MISSION shRNA shRNA Plasmid DNA
hepatocyte growth factor-regulated tyrosine kinase substrate
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-235s21c1
Sequence:CCGGCCATCAAGAAGAAGGTTAATGCTCGAGCATTAACCTTCTTCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-331s21c1
Sequence:CCGGATGATGAAGTGGCCAACAAACCTCGAGGTTTGTTGGCCACTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-508s21c1
Sequence:CCGGGACATGTCTTCCCTGAATTTACTCGAGTAAATTCAGGGAAGACATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-2198s21c1
Sequence:CCGGGGGCTACCAGCCGTACAATATCTCGAGATATTGTACGGCTGGTAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-463s1c1
Sequence:CCGGCCTGAATTTAAGGAAAGTGATCTCGAGATCACTTTCCTTAAATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-2148s1c1
Sequence:CCGGCCAGCCGTACAATATGCAGAACTCGAGTTCTGCATATTGTACGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-2151s1c1
Sequence:CCGGGCCGTACAATATGCAGAATCTCTCGAGAGATTCTGCATATTGTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-1204s1c1
Sequence:CCGGCCCTTTAGTGAGTACCAGAATCTCGAGATTCTGGTACTCACTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008244.2-2675s1c1
Sequence:CCGGCCGGAGTCTGATGTGAACTAACTCGAGTTAGTTCACATCAGACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-382s21c1
Sequence:GTACCGGAGAGGCAAGTGGAAGTTAATGCTCGAGCATTAACTTCCACTTGCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-291s21c1
Sequence:GTACCGGGTGATGGAGTCTGTGGTAAAGCTCGAGCTTTACCACAGACTCCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-2731s21c1
Sequence:CCGGCCGGAGTCTGATGTGAACTAACTCGAGTTAGTTCACATCAGACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-1261s21c1
Sequence:GTACCGGCCTTTAGTGAGTACCAGAATGCTCGAGCATTCTGGTACTCACTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-539s21c1
Sequence:GTACCGGTGCCATGTTCGCTGCTGAAAGCTCGAGCTTTCAGCAGCGAACATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008244
VALIDATED
HGS MISSION shRNA Lentiviral Transduction Particles
hepatocyte growth factor-regulated tyrosine kinase substrate
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-235s21c1
Sequence:CCGGCCATCAAGAAGAAGGTTAATGCTCGAGCATTAACCTTCTTCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-331s21c1
Sequence:CCGGATGATGAAGTGGCCAACAAACCTCGAGGTTTGTTGGCCACTTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-508s21c1
Sequence:CCGGGACATGTCTTCCCTGAATTTACTCGAGTAAATTCAGGGAAGACATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-2198s21c1
Sequence:CCGGGGGCTACCAGCCGTACAATATCTCGAGATATTGTACGGCTGGTAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-463s1c1
Sequence:CCGGCCTGAATTTAAGGAAAGTGATCTCGAGATCACTTTCCTTAAATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-2148s1c1
Sequence:CCGGCCAGCCGTACAATATGCAGAACTCGAGTTCTGCATATTGTACGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-2151s1c1
Sequence:CCGGGCCGTACAATATGCAGAATCTCTCGAGAGATTCTGCATATTGTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008244.2-1204s1c1
Sequence:CCGGCCCTTTAGTGAGTACCAGAATCTCGAGATTCTGGTACTCACTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008244.2-2675s1c1
Sequence:CCGGCCGGAGTCTGATGTGAACTAACTCGAGTTAGTTCACATCAGACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-382s21c1
Sequence:GTACCGGAGAGGCAAGTGGAAGTTAATGCTCGAGCATTAACTTCCACTTGCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-291s21c1
Sequence:GTACCGGGTGATGGAGTCTGTGGTAAAGCTCGAGCTTTACCACAGACTCCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008244.3-2731s21c1
Sequence:CCGGCCGGAGTCTGATGTGAACTAACTCGAGTTAGTTCACATCAGACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-1261s21c1
Sequence:GTACCGGCCTTTAGTGAGTACCAGAATGCTCGAGCATTCTGGTACTCACTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008244.3-539s21c1
Sequence:GTACCGGTGCCATGTTCGCTGCTGAAAGCTCGAGCTTTCAGCAGCGAACATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)