EMAIL THIS PAGE TO A FRIEND

HGSNAT

heparan-alpha-glucosaminide N-acetyltransferase

51 Gene Product Result for
Synonyms: HGNAT MPS3C TMEM76
UniProtKB ID: Q68CP4, B4E2V0
Gene ID:
Human(138050) Summary: This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
Mouse(52120) heparan-alpha-glucosaminide N-acetyltransferase
sheep(101102037) heparan-alpha-glucosaminide N-acetyltransferase
Domestic Rabbit(100355407) heparan-alpha-glucosaminide N-acetyltransferase
domestic guinea pig(100734837) heparan-alpha-glucosaminide N-acetyltransferase
naked mole-rat(101698026) heparan-alpha-glucosaminide N-acetyltransferase
chicken(422490) heparan-alpha-glucosaminide N-acetyltransferase
dog(482833) heparan-alpha-glucosaminide N-acetyltransferase
domestic cat(101101049) heparan-alpha-glucosaminide N-acetyltransferase
cow(511607) heparan-alpha-glucosaminide N-acetyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152419 Rosetta Predictions human pricing
XM_372038 Rosetta Predictions human pricing
NM_029884 Rosetta Predictions mouse pricing
NM_133970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366141 predicted 399
2 SASI_Hs02_00366142 predicted 445
3 SASI_Hs02_00366143 predicted 795
4 SASI_Hs02_00366144 predicted 1919
5 SASI_Hs02_00366145 predicted 569
6 SASI_Hs02_00366146 predicted 463
7 SASI_Hs02_00366147 predicted 1769
8 SASI_Hs02_00366148 predicted 269
9 SASI_Hs02_00366149 predicted 1027
10 SASI_Hs02_00366150 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298970 predicted 403
2 SASI_Hs01_00298971 predicted 441
3 SASI_Hs01_00298972 predicted 790
4 SASI_Hs01_00298973 predicted 569
5 SASI_Hs01_00298974 predicted 459
6 SASI_Hs01_00298975 predicted 1765
7 SASI_Hs01_00298976 predicted 263
8 SASI_Hs01_00298977 predicted 1016
9 SASI_Hs01_00298978 predicted 1557
10 SASI_Hs01_00298979 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336107 predicted 1639
2 SASI_Mm02_00336108 predicted 628
3 SASI_Mm02_00336109 predicted 1374
4 SASI_Mm02_00336110 predicted 1624
5 SASI_Mm02_00336111 predicted 1507
6 SASI_Mm02_00336112 predicted 1052
7 SASI_Mm02_00336113 predicted 1432
8 SASI_Mm02_00336114 predicted 679
9 SASI_Mm02_00336115 predicted 1345
10 SASI_Mm02_00336116 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122360 predicted 551
2 SASI_Mm01_00122361 predicted 558
3 SASI_Mm01_00122362 predicted 532
4 SASI_Mm01_00122363 predicted 544
5 SASI_Mm01_00122364 predicted 553
6 SASI_Mm01_00122365 predicted 618
7 SASI_Mm01_00122366 predicted 616
8 SASI_Mm01_00122367 predicted 533
9 SASI_Mm01_00122368 predicted 617
10 SASI_Mm01_00122369 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029884
VALIDATED
HGSNAT MISSION shRNA Bacterial Glycerol Stock
heparan-alpha-glucosaminide N-acetyltransferase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000351802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2224s21c1
Sequence:CCGGCATGTGTGGAAATCTTGTTTACTCGAGTAAACAAGATTTCCACACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029884.1-1960s21c1
Sequence:CCGGATCGCCTACGTGCTCTATAAACTCGAGTTTATAGAGCACGTAGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2304s21c1
Sequence:CCGGCTGTGCTTGATTCAGAGAGAACTCGAGTTCTCTCTGAATCAAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2251s21c1
Sequence:CCGGCAGAGATTTACTCTGGACATTCTCGAGAATGTCCAGAGTAAATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029884
VALIDATED
HGSNAT MISSION shRNA shRNA Plasmid DNA
heparan-alpha-glucosaminide N-acetyltransferase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000351802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2224s21c1
Sequence:CCGGCATGTGTGGAAATCTTGTTTACTCGAGTAAACAAGATTTCCACACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029884.1-1960s21c1
Sequence:CCGGATCGCCTACGTGCTCTATAAACTCGAGTTTATAGAGCACGTAGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2304s21c1
Sequence:CCGGCTGTGCTTGATTCAGAGAGAACTCGAGTTCTCTCTGAATCAAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2251s21c1
Sequence:CCGGCAGAGATTTACTCTGGACATTCTCGAGAATGTCCAGAGTAAATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029884
VALIDATED
HGSNAT MISSION shRNA Lentiviral Transduction Particles
heparan-alpha-glucosaminide N-acetyltransferase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000351802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2224s21c1
Sequence:CCGGCATGTGTGGAAATCTTGTTTACTCGAGTAAACAAGATTTCCACACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029884.1-1960s21c1
Sequence:CCGGATCGCCTACGTGCTCTATAAACTCGAGTTTATAGAGCACGTAGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2304s21c1
Sequence:CCGGCTGTGCTTGATTCAGAGAGAACTCGAGTTCTCTCTGAATCAAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029884.1-2251s21c1
Sequence:CCGGCAGAGATTTACTCTGGACATTCTCGAGAATGTCCAGAGTAAATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152419
VALIDATED
HGSNAT MISSION shRNA Bacterial Glycerol Stock
heparan-alpha-glucosaminide N-acetyltransferase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000257523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152419.2-5036s21c1
Sequence:CCGGTACTGCCGCTGTAGATCATAACTCGAGTTATGATCTACAGCGGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-1028s21c1
Sequence:CCGGTCATTGTGAATCCCAATTATTCTCGAGAATAATTGGGATTCACAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-459s21c1
Sequence:CCGGCTTGGTAAAGAACATCCATAACTCGAGTTATGGATGTTCTTTACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-517s21c1
Sequence:CCGGGAGGATCCAGTTGATAGTAACCTCGAGGTTACTATCAACTGGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152419
VALIDATED
HGSNAT MISSION shRNA shRNA Plasmid DNA
heparan-alpha-glucosaminide N-acetyltransferase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000257523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152419.2-5036s21c1
Sequence:CCGGTACTGCCGCTGTAGATCATAACTCGAGTTATGATCTACAGCGGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-1028s21c1
Sequence:CCGGTCATTGTGAATCCCAATTATTCTCGAGAATAATTGGGATTCACAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-459s21c1
Sequence:CCGGCTTGGTAAAGAACATCCATAACTCGAGTTATGGATGTTCTTTACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-517s21c1
Sequence:CCGGGAGGATCCAGTTGATAGTAACCTCGAGGTTACTATCAACTGGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152419
VALIDATED
HGSNAT MISSION shRNA Lentiviral Transduction Particles
heparan-alpha-glucosaminide N-acetyltransferase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000257523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152419.2-5036s21c1
Sequence:CCGGTACTGCCGCTGTAGATCATAACTCGAGTTATGATCTACAGCGGCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-1028s21c1
Sequence:CCGGTCATTGTGAATCCCAATTATTCTCGAGAATAATTGGGATTCACAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-459s21c1
Sequence:CCGGCTTGGTAAAGAACATCCATAACTCGAGTTATGGATGTTCTTTACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_152419.2-517s21c1
Sequence:CCGGGAGGATCCAGTTGATAGTAACCTCGAGGTTACTATCAACTGGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133970
VALIDATED
HGSNAT MISSION shRNA Bacterial Glycerol Stock
heparan-alpha-glucosaminide N-acetyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-631s1c1
Sequence:CCGGCTGTGCTTGATTCAGAGAGAACTCGAGTTCTCTCTGAATCAAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-578s1c1
Sequence:CCGGCAGAGATTTACTCTGGACATTCTCGAGAATGTCCAGAGTAAATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133970.1-819s1c1
Sequence:CCGGGACTGTGTCATGTTGTCTGATCTCGAGATCAGACAACATGACACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-551s1c1
Sequence:CCGGCATGTGTGGAAATCTTGTTTACTCGAGTAAACAAGATTTCCACACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-577s1c1
Sequence:CCGGTCAGAGATTTACTCTGGACATCTCGAGATGTCCAGAGTAAATCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133970
VALIDATED
HGSNAT MISSION shRNA shRNA Plasmid DNA
heparan-alpha-glucosaminide N-acetyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-631s1c1
Sequence:CCGGCTGTGCTTGATTCAGAGAGAACTCGAGTTCTCTCTGAATCAAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-578s1c1
Sequence:CCGGCAGAGATTTACTCTGGACATTCTCGAGAATGTCCAGAGTAAATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133970.1-819s1c1
Sequence:CCGGGACTGTGTCATGTTGTCTGATCTCGAGATCAGACAACATGACACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-551s1c1
Sequence:CCGGCATGTGTGGAAATCTTGTTTACTCGAGTAAACAAGATTTCCACACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-577s1c1
Sequence:CCGGTCAGAGATTTACTCTGGACATCTCGAGATGTCCAGAGTAAATCTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133970
VALIDATED
HGSNAT MISSION shRNA Lentiviral Transduction Particles
heparan-alpha-glucosaminide N-acetyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-631s1c1
Sequence:CCGGCTGTGCTTGATTCAGAGAGAACTCGAGTTCTCTCTGAATCAAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-578s1c1
Sequence:CCGGCAGAGATTTACTCTGGACATTCTCGAGAATGTCCAGAGTAAATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133970.1-819s1c1
Sequence:CCGGGACTGTGTCATGTTGTCTGATCTCGAGATCAGACAACATGACACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-551s1c1
Sequence:CCGGCATGTGTGGAAATCTTGTTTACTCGAGTAAACAAGATTTCCACACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133970.1-577s1c1
Sequence:CCGGTCAGAGATTTACTCTGGACATCTCGAGATGTCCAGAGTAAATCTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)