EMAIL THIS PAGE TO A FRIEND

HHAT

hedgehog acyltransferase

84 Gene Product Result for
Synonyms: MART2 SKI1 Skn
Gene ID:
Human(55733) Summary: 'Skinny hedgehog' (SKI1) encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' (see MIM 600725).[supplied by OMIM, Jul 2002]
Mouse(226861) hedgehog acyltransferase
Rat(289344) hedgehog acyltransferase
sheep(101104416) hedgehog acyltransferase
Domestic Rabbit(100348255) hedgehog acyltransferase
domestic guinea pig(100731120) hedgehog acyltransferase
naked mole-rat(101705986) hedgehog acyltransferase
Zebrafish(560334) hedgehog acyltransferase
cow(100336796) hedgehog acyltransferase
Horse(100055589) hedgehog acyltransferase
domestic cat(101093413) hedgehog acyltransferase
dog(480017) hedgehog acyltransferase
chicken(771269) hedgehog acyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018194 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122834 Rosetta Predictions human pricing
NM_018194 Rosetta Predictions human pricing
XM_223026 Rosetta Predictions rat pricing
XR_008636 Rosetta Predictions rat pricing
NM_144881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327427 predicted 740
2 SASI_Hs02_00327428 predicted 824
3 SASI_Hs02_00327429 predicted 1023
4 SASI_Hs02_00327430 predicted 832
5 SASI_Hs02_00327431 predicted 411
6 SASI_Hs02_00327432 predicted 1532
7 SASI_Hs02_00327433 predicted 1333
8 SASI_Hs02_00327434 predicted 597
9 SASI_Hs02_00327435 predicted 1579
10 SASI_Hs02_00327436 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351466 predicted 801
2 SASI_Hs02_00351467 predicted 889
3 SASI_Hs02_00351468 predicted 1085
4 SASI_Hs02_00351469 predicted 895
5 SASI_Hs02_00351470 predicted 472
6 SASI_Hs01_00056560 predicted 1594
7 SASI_Hs02_00351471 predicted 1394
8 SASI_Hs02_00351472 predicted 661
9 SASI_Hs02_00351473 predicted 1639
10 SASI_Hs02_00351474 predicted 1086
11 SASI_Hs01_00056555 predicted 253
12 SASI_Hs01_00056556 predicted 360
13 SASI_Hs01_00056557 predicted 1312
14 SASI_Hs01_00056558 predicted 330
15 SASI_Hs01_00056559 predicted 335
16 SASI_Hs01_00056561 predicted 1222
17 SASI_Hs01_00056562 predicted 347
18 SASI_Hs01_00056563 predicted 1224
19 SASI_Hs01_00056564 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160479 predicted 3068
2 SASI_Rn01_00160480 predicted 3538
3 SASI_Rn01_00160481 predicted 3568
4 SASI_Rn01_00160482 predicted 3131
5 SASI_Rn01_00160483 predicted 3070
6 SASI_Rn01_00160484 predicted 3161
7 SASI_Rn01_00160485 predicted 3079
8 SASI_Rn01_00160486 predicted 3573
9 SASI_Rn01_00160487 predicted 3124
10 SASI_Rn01_00160488 predicted 3630
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147048 predicted 350
2 SASI_Rn01_00147049 predicted 381
3 SASI_Rn01_00147050 predicted 534
4 SASI_Rn02_00417560 predicted 347
5 SASI_Rn01_00147051 predicted 1151
6 SASI_Rn01_00147052 predicted 1139
7 SASI_Rn01_00147053 predicted 225
8 SASI_Rn01_00147054 predicted 885
9 SASI_Rn02_00417561 predicted 730
10 SASI_Rn01_00147055 predicted 232
11 SASI_Rn01_00147056 predicted 1143
12 SASI_Rn01_00147057 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103921 predicted 1539
2 SASI_Mm01_00103922 predicted 1559
3 SASI_Mm01_00103923 predicted 357
4 SASI_Mm01_00103925 predicted 308
5 SASI_Mm01_00103926 predicted 211
6 SASI_Mm01_00103927 predicted 575
7 SASI_Mm01_00103928 predicted 519
8 SASI_Mm01_00103929 predicted 1188
9 SASI_Mm01_00103930 predicted 1634
10 SASI_Mm02_00340331 predicted 1621
11 SASI_Mm01_00103924 predicted 1537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018194
HHAT MISSION shRNA Bacterial Glycerol Stock
hedgehog acyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-476s1c1
Sequence:CCGGCCCTGGATTCTCATGCTCTATCTCGAGATAGAGCATGAGAATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-426s1c1
Sequence:CCGGGCCACATGGTAGTGTCTCAAACTCGAGTTTGAGACACTACCATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-1168s1c1
Sequence:CCGGCGTGAGCACCATGTTCAGTTTCTCGAGAAACTGAACATGGTGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-550s1c1
Sequence:CCGGGCTCCATACCACCATCTCTTTCTCGAGAAAGAGATGGTGGTATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-1575s1c1
Sequence:CCGGTCTTCATACAAGGCTGGCCTTCTCGAGAAGGCCAGCCTTGTATGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018194.4-1255s21c1
Sequence:CCGGTTGATGTTGGACTGCATAATTCTCGAGAATTATGCAGTCCAACATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018194.4-377s21c1
Sequence:CCGGCACTTTATTTGGAGGATTAAACTCGAGTTTAATCCTCCAAATAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018194.4-1856s21c1
Sequence:CCGGACTGGATGCTGGATCTCATAGCTCGAGCTATGAGATCCAGCATCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018194
HHAT MISSION shRNA shRNA Plasmid DNA
hedgehog acyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-476s1c1
Sequence:CCGGCCCTGGATTCTCATGCTCTATCTCGAGATAGAGCATGAGAATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-426s1c1
Sequence:CCGGGCCACATGGTAGTGTCTCAAACTCGAGTTTGAGACACTACCATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-1168s1c1
Sequence:CCGGCGTGAGCACCATGTTCAGTTTCTCGAGAAACTGAACATGGTGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-550s1c1
Sequence:CCGGGCTCCATACCACCATCTCTTTCTCGAGAAAGAGATGGTGGTATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-1575s1c1
Sequence:CCGGTCTTCATACAAGGCTGGCCTTCTCGAGAAGGCCAGCCTTGTATGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018194.4-1255s21c1
Sequence:CCGGTTGATGTTGGACTGCATAATTCTCGAGAATTATGCAGTCCAACATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018194.4-377s21c1
Sequence:CCGGCACTTTATTTGGAGGATTAAACTCGAGTTTAATCCTCCAAATAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018194.4-1856s21c1
Sequence:CCGGACTGGATGCTGGATCTCATAGCTCGAGCTATGAGATCCAGCATCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018194
HHAT MISSION shRNA Lentiviral Transduction Particles
hedgehog acyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-476s1c1
Sequence:CCGGCCCTGGATTCTCATGCTCTATCTCGAGATAGAGCATGAGAATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-426s1c1
Sequence:CCGGGCCACATGGTAGTGTCTCAAACTCGAGTTTGAGACACTACCATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-1168s1c1
Sequence:CCGGCGTGAGCACCATGTTCAGTTTCTCGAGAAACTGAACATGGTGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-550s1c1
Sequence:CCGGGCTCCATACCACCATCTCTTTCTCGAGAAAGAGATGGTGGTATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018194.1-1575s1c1
Sequence:CCGGTCTTCATACAAGGCTGGCCTTCTCGAGAAGGCCAGCCTTGTATGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018194.4-1255s21c1
Sequence:CCGGTTGATGTTGGACTGCATAATTCTCGAGAATTATGCAGTCCAACATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018194.4-377s21c1
Sequence:CCGGCACTTTATTTGGAGGATTAAACTCGAGTTTAATCCTCCAAATAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018194.4-1856s21c1
Sequence:CCGGACTGGATGCTGGATCTCATAGCTCGAGCTATGAGATCCAGCATCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144881
HHAT MISSION shRNA Bacterial Glycerol Stock
hedgehog acyltransferase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144881.2-1874s1c1
Sequence:CCGGGCTTCATCAATCACAGTAAATCTCGAGATTTACTGTGATTGATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144881.2-754s1c1
Sequence:CCGGCATCCTTAACTTCCCGGAGTTCTCGAGAACTCCGGGAAGTTAAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-560s21c1
Sequence:CCGGACAAGACAGAGAACGAGTATTCTCGAGAATACTCGTTCTCTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144881.3-1874s21c1
Sequence:CCGGCTTCATCAATCACAGTAAATACTCGAGTATTTACTGTGATTGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-138s21c1
Sequence:CCGGCCGCTCTTTCTATGAAGTTTACTCGAGTAAACTTCATAGAAAGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-234s21c1
Sequence:CCGGGAAGAAGGACCCGACTGATTTCTCGAGAAATCAGTCGGGTCCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-204s21c1
Sequence:CCGGGCTGGAGATGGACACTCTATTCTCGAGAATAGAGTGTCCATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144881
HHAT MISSION shRNA shRNA Plasmid DNA
hedgehog acyltransferase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144881.2-1874s1c1
Sequence:CCGGGCTTCATCAATCACAGTAAATCTCGAGATTTACTGTGATTGATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144881.2-754s1c1
Sequence:CCGGCATCCTTAACTTCCCGGAGTTCTCGAGAACTCCGGGAAGTTAAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-560s21c1
Sequence:CCGGACAAGACAGAGAACGAGTATTCTCGAGAATACTCGTTCTCTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144881.3-1874s21c1
Sequence:CCGGCTTCATCAATCACAGTAAATACTCGAGTATTTACTGTGATTGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-138s21c1
Sequence:CCGGCCGCTCTTTCTATGAAGTTTACTCGAGTAAACTTCATAGAAAGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-234s21c1
Sequence:CCGGGAAGAAGGACCCGACTGATTTCTCGAGAAATCAGTCGGGTCCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-204s21c1
Sequence:CCGGGCTGGAGATGGACACTCTATTCTCGAGAATAGAGTGTCCATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144881
HHAT MISSION shRNA Lentiviral Transduction Particles
hedgehog acyltransferase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144881.2-1874s1c1
Sequence:CCGGGCTTCATCAATCACAGTAAATCTCGAGATTTACTGTGATTGATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144881.2-754s1c1
Sequence:CCGGCATCCTTAACTTCCCGGAGTTCTCGAGAACTCCGGGAAGTTAAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-560s21c1
Sequence:CCGGACAAGACAGAGAACGAGTATTCTCGAGAATACTCGTTCTCTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144881.3-1874s21c1
Sequence:CCGGCTTCATCAATCACAGTAAATACTCGAGTATTTACTGTGATTGATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-138s21c1
Sequence:CCGGCCGCTCTTTCTATGAAGTTTACTCGAGTAAACTTCATAGAAAGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-234s21c1
Sequence:CCGGGAAGAAGGACCCGACTGATTTCTCGAGAAATCAGTCGGGTCCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144881.3-204s21c1
Sequence:CCGGGCTGGAGATGGACACTCTATTCTCGAGAATAGAGTGTCCATCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)