EMAIL THIS PAGE TO A FRIEND

HHATL

hedgehog acyltransferase-like

48 Gene Product Result for
Synonyms: C3orf3 GUP1 MBOAT3 MSTP002 OACT3
UniProtKB ID: Q9HCP6, Q8TBG3, Q9ULP7
Gene ID:
Mouse(74770) hedgehog acyltransferase-like
Rat(301073) hedgehog acyltransferase-like
chicken(420391) hedgehog acyltransferase-like
dog(477036) hedgehog acyltransferase-like
cow(516072) hedgehog acyltransferase-like
Horse(100146124) hedgehog acyltransferase-like
domestic cat(101095126) hedgehog acyltransferase-like
domestic guinea pig(100734006) hedgehog acyltransferase-like
naked mole-rat(101714074) hedgehog acyltransferase-like
sheep(101117452) hedgehog acyltransferase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066501 MISSION® esiRNA esiRNA human GUP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020707 Rosetta Predictions human pricing
NM_001106868 Rosetta Predictions rat pricing
NM_029095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201827 predicted 1297
2 SASI_Hs01_00201828 predicted 526
3 SASI_Hs01_00201829 predicted 340
4 SASI_Hs01_00201830 predicted 1153
5 SASI_Hs01_00201831 predicted 1331
6 SASI_Hs01_00201832 predicted 1257
7 SASI_Hs01_00201833 predicted 1318
8 SASI_Hs01_00201834 predicted 1254
9 SASI_Hs01_00201835 predicted 1478
10 SASI_Hs01_00201836 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223196 predicted 1450
2 SASI_Rn02_00223197 predicted 1172
3 SASI_Rn02_00223198 predicted 404
4 SASI_Rn02_00223199 predicted 940
5 SASI_Rn02_00223200 predicted 1455
6 SASI_Rn02_00223201 predicted 1048
7 SASI_Rn02_00223202 predicted 230
8 SASI_Rn02_00223203 predicted 355
9 SASI_Rn02_00223204 predicted 338
10 SASI_Rn02_00223205 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184781 predicted 1155
2 SASI_Mm01_00184782 predicted 616
3 SASI_Mm01_00184784 predicted 1364
4 SASI_Mm01_00184786 predicted 1105
5 SASI_Mm01_00184787 predicted 428
6 SASI_Mm02_00334861 predicted 329
7 SASI_Mm02_00334862 predicted 342
8 SASI_Mm01_00184788 predicted 1468
9 SASI_Mm02_00334863 predicted 307
10 SASI_Mm01_00184789 predicted 1165
11 SASI_Mm01_00184783 predicted 1429
12 SASI_Mm01_00184785 predicted 1430
13 SASI_Mm01_00184790 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020707
HHATL MISSION shRNA Bacterial Glycerol Stock
hedgehog acyltransferase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-792s1c1
Sequence:CCGGCTTCTTCTTCTTCGGGCCAATCTCGAGATTGGCCCGAAGAAGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1434s1c1
Sequence:CCGGCCTGTTTGGAGCCATGAACTTCTCGAGAAGTTCATGGCTCCAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1305s1c1
Sequence:CCGGCTACCTGTGGTCATTCCTTAACTCGAGTTAAGGAATGACCACAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-930s1c1
Sequence:CCGGCGACATCTTCTTTCACTTCTTCTCGAGAAGAAGTGAAAGAAGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1021s1c1
Sequence:CCGGGCCTATTCAAACCTGGTGTATCTCGAGATACACCAGGTTTGAATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-402s1c1
Sequence:CCGGGTTTGCTAAACTCTGCACGATCTCGAGATCGTGCAGAGTTTAGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-927s1c1
Sequence:CCGGCGTCGACATCTTCTTTCACTTCTCGAGAAGTGAAAGAAGATGTCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1482s1c1
Sequence:CCGGGAGCCTGAACAGCCTCAAATTCTCGAGAATTTGAGGCTGTTCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-343s1c1
Sequence:CCGGGTGATGTGGTTCACCTCCTTTCTCGAGAAAGGAGGTGAACCACATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1470s1c1
Sequence:CCGGGTACAACCTTGTGAGCCTGAACTCGAGTTCAGGCTCACAAGGTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020707
HHATL MISSION shRNA shRNA Plasmid DNA
hedgehog acyltransferase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-792s1c1
Sequence:CCGGCTTCTTCTTCTTCGGGCCAATCTCGAGATTGGCCCGAAGAAGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1434s1c1
Sequence:CCGGCCTGTTTGGAGCCATGAACTTCTCGAGAAGTTCATGGCTCCAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1305s1c1
Sequence:CCGGCTACCTGTGGTCATTCCTTAACTCGAGTTAAGGAATGACCACAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-930s1c1
Sequence:CCGGCGACATCTTCTTTCACTTCTTCTCGAGAAGAAGTGAAAGAAGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1021s1c1
Sequence:CCGGGCCTATTCAAACCTGGTGTATCTCGAGATACACCAGGTTTGAATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-402s1c1
Sequence:CCGGGTTTGCTAAACTCTGCACGATCTCGAGATCGTGCAGAGTTTAGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-927s1c1
Sequence:CCGGCGTCGACATCTTCTTTCACTTCTCGAGAAGTGAAAGAAGATGTCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1482s1c1
Sequence:CCGGGAGCCTGAACAGCCTCAAATTCTCGAGAATTTGAGGCTGTTCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-343s1c1
Sequence:CCGGGTGATGTGGTTCACCTCCTTTCTCGAGAAAGGAGGTGAACCACATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1470s1c1
Sequence:CCGGGTACAACCTTGTGAGCCTGAACTCGAGTTCAGGCTCACAAGGTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020707
HHATL MISSION shRNA Lentiviral Transduction Particles
hedgehog acyltransferase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-792s1c1
Sequence:CCGGCTTCTTCTTCTTCGGGCCAATCTCGAGATTGGCCCGAAGAAGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1434s1c1
Sequence:CCGGCCTGTTTGGAGCCATGAACTTCTCGAGAAGTTCATGGCTCCAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1305s1c1
Sequence:CCGGCTACCTGTGGTCATTCCTTAACTCGAGTTAAGGAATGACCACAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-930s1c1
Sequence:CCGGCGACATCTTCTTTCACTTCTTCTCGAGAAGAAGTGAAAGAAGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1021s1c1
Sequence:CCGGGCCTATTCAAACCTGGTGTATCTCGAGATACACCAGGTTTGAATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-402s1c1
Sequence:CCGGGTTTGCTAAACTCTGCACGATCTCGAGATCGTGCAGAGTTTAGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-927s1c1
Sequence:CCGGCGTCGACATCTTCTTTCACTTCTCGAGAAGTGAAAGAAGATGTCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1482s1c1
Sequence:CCGGGAGCCTGAACAGCCTCAAATTCTCGAGAATTTGAGGCTGTTCAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-343s1c1
Sequence:CCGGGTGATGTGGTTCACCTCCTTTCTCGAGAAAGGAGGTGAACCACATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020707.2-1470s1c1
Sequence:CCGGGTACAACCTTGTGAGCCTGAACTCGAGTTCAGGCTCACAAGGTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029095
HHATL MISSION shRNA Bacterial Glycerol Stock
hedgehog acyltransferase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1006s1c1
Sequence:CCGGGCGTACTCAAACCTGGTGTATCTCGAGATACACCAGGTTTGAGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1467s1c1
Sequence:CCGGGAGCCTGAACAGCCTTGAATTCTCGAGAATTCAAGGCTGTTCAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1152s1c1
Sequence:CCGGCCGTGGTATCAATGATTGGCTCTCGAGAGCCAATCATTGATACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1153s1c1
Sequence:CCGGCGTGGTATCAATGATTGGCTTCTCGAGAAGCCAATCATTGATACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-762s1c1
Sequence:CCGGGTACAATTTCTACTTGCCCTTCTCGAGAAGGGCAAGTAGAAATTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029095
HHATL MISSION shRNA shRNA Plasmid DNA
hedgehog acyltransferase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1006s1c1
Sequence:CCGGGCGTACTCAAACCTGGTGTATCTCGAGATACACCAGGTTTGAGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1467s1c1
Sequence:CCGGGAGCCTGAACAGCCTTGAATTCTCGAGAATTCAAGGCTGTTCAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1152s1c1
Sequence:CCGGCCGTGGTATCAATGATTGGCTCTCGAGAGCCAATCATTGATACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1153s1c1
Sequence:CCGGCGTGGTATCAATGATTGGCTTCTCGAGAAGCCAATCATTGATACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-762s1c1
Sequence:CCGGGTACAATTTCTACTTGCCCTTCTCGAGAAGGGCAAGTAGAAATTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029095
HHATL MISSION shRNA Lentiviral Transduction Particles
hedgehog acyltransferase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1006s1c1
Sequence:CCGGGCGTACTCAAACCTGGTGTATCTCGAGATACACCAGGTTTGAGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1467s1c1
Sequence:CCGGGAGCCTGAACAGCCTTGAATTCTCGAGAATTCAAGGCTGTTCAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1152s1c1
Sequence:CCGGCCGTGGTATCAATGATTGGCTCTCGAGAGCCAATCATTGATACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-1153s1c1
Sequence:CCGGCGTGGTATCAATGATTGGCTTCTCGAGAAGCCAATCATTGATACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029095.1-762s1c1
Sequence:CCGGGTACAATTTCTACTTGCCCTTCTCGAGAAGGGCAAGTAGAAATTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)