EMAIL THIS PAGE TO A FRIEND

HHCM

7 Gene Product Result for
Synonyms: hhc(M)
Species: Human HHCM(10639)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006543 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001731 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059001 predicted 16
2 SASI_Hs01_00059002 predicted 40
3 SASI_Hs01_00059003 predicted 75
4 SASI_Hs01_00059004 predicted 41
5 SASI_Hs01_00059005 predicted 79
6 SASI_Hs01_00059006 predicted 69
7 SASI_Hs01_00059007 predicted 47
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006543
HHCM MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006543.1-957s1c1
Sequence:CCGGCAACCACATCAATTGCTGCAACTCGAGTTGCAGCAATTGATGTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-1191s1c1
Sequence:CCGGGCAAGTAATGGCAAACACTCTCTCGAGAGAGTGTTTGCCATTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-668s1c1
Sequence:CCGGCCAAAGAAGAATCCCAGGTGACTCGAGTCACCTGGGATTCTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006543.1-798s1c1
Sequence:CCGGGACCCTCGATGGAATAGACTACTCGAGTAGTCTATTCCATCGAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-945s1c1
Sequence:CCGGGCAACATAAGCCCAACCACATCTCGAGATGTGGTTGGGCTTATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-736s1c1
Sequence:CCGGCAATCCATCGTGTTGTCAGTACTCGAGTACTGACAACACGATGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-238s1c1
Sequence:CCGGCAAATGGACACTCTGATCATACTCGAGTATGATCAGAGTGTCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006543
HHCM MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006543.1-957s1c1
Sequence:CCGGCAACCACATCAATTGCTGCAACTCGAGTTGCAGCAATTGATGTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-1191s1c1
Sequence:CCGGGCAAGTAATGGCAAACACTCTCTCGAGAGAGTGTTTGCCATTACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-668s1c1
Sequence:CCGGCCAAAGAAGAATCCCAGGTGACTCGAGTCACCTGGGATTCTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006543.1-798s1c1
Sequence:CCGGGACCCTCGATGGAATAGACTACTCGAGTAGTCTATTCCATCGAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-945s1c1
Sequence:CCGGGCAACATAAGCCCAACCACATCTCGAGATGTGGTTGGGCTTATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-736s1c1
Sequence:CCGGCAATCCATCGTGTTGTCAGTACTCGAGTACTGACAACACGATGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-238s1c1
Sequence:CCGGCAAATGGACACTCTGATCATACTCGAGTATGATCAGAGTGTCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006543
HHCM MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006543.1-957s1c1
Sequence:CCGGCAACCACATCAATTGCTGCAACTCGAGTTGCAGCAATTGATGTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-1191s1c1
Sequence:CCGGGCAAGTAATGGCAAACACTCTCTCGAGAGAGTGTTTGCCATTACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-668s1c1
Sequence:CCGGCCAAAGAAGAATCCCAGGTGACTCGAGTCACCTGGGATTCTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006543.1-798s1c1
Sequence:CCGGGACCCTCGATGGAATAGACTACTCGAGTAGTCTATTCCATCGAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-945s1c1
Sequence:CCGGGCAACATAAGCCCAACCACATCTCGAGATGTGGTTGGGCTTATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-736s1c1
Sequence:CCGGCAATCCATCGTGTTGTCAGTACTCGAGTACTGACAACACGATGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006543.1-238s1c1
Sequence:CCGGCAAATGGACACTCTGATCATACTCGAGTATGATCAGAGTGTCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)