EMAIL THIS PAGE TO A FRIEND

HHEX

hematopoietically expressed homeobox

72 Gene Product Result for
Synonyms: HEX HMPH HOX11L-PEN PRH PRHX
UniProtKB ID: Q03014, B1AQ17, Q96CE9
Gene ID:
Human(3087) Summary: This gene encodes a member of the homeobox family of transcription factors, many of which are involved in developmental processes. Expression in specific hematopoietic lineages suggests that this protein may play a role in hematopoietic differentiation. [provided by RefSeq, Jul 2008]
Mouse(15242) hematopoietically expressed homeobox
Rat(79237) hematopoietically expressed homeobox
Zebrafish(30098) hematopoietically expressed homeobox
chicken(396182) hematopoietically expressed homeobox
cow(539542) hematopoietically expressed homeobox
domestic cat(101085923) hematopoietically expressed homeobox
dog(608175) hematopoietically expressed homeobox
sheep(101104445) hematopoietically expressed homeobox
naked mole-rat(101697305) hematopoietically expressed homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002729 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002729 Rosetta Predictions human pricing
NM_024385 Rosetta Predictions rat pricing
NM_008245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207444 predicted 621
2 SASI_Hs01_00207445 predicted 831
3 SASI_Hs01_00207446 predicted 792
4 SASI_Hs02_00334332 predicted 609
5 SASI_Hs01_00207447 predicted 709
6 SASI_Hs01_00207448 predicted 695
7 SASI_Hs01_00207449 predicted 626
8 SASI_Hs01_00207451 predicted 884
9 SASI_Hs01_00207452 predicted 696
10 SASI_Hs01_00207453 predicted 623
11 SASI_Hs01_00207450 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055316 predicted 1244
2 SASI_Rn01_00055317 predicted 597
3 SASI_Rn01_00055318 predicted 1160
4 SASI_Rn01_00055319 predicted 896
5 SASI_Rn01_00055320 predicted 1045
6 SASI_Rn02_00263984 predicted 604
7 SASI_Rn01_00055322 predicted 841
8 SASI_Rn01_00055324 predicted 907
9 SASI_Rn01_00055325 predicted 1314
10 SASI_Rn02_00263985 predicted 1210
11 SASI_Rn01_00055321 predicted 1093
12 SASI_Rn01_00055323 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154513 predicted 1297
2 SASI_Mm01_00154514 predicted 1212
3 SASI_Mm01_00154515 predicted 663
4 SASI_Mm01_00154516 predicted 354
5 SASI_Mm02_00313437 predicted 1210
6 SASI_Mm01_00154517 predicted 1247
7 SASI_Mm01_00154518 predicted 1290
8 SASI_Mm01_00154519 predicted 520
9 SASI_Mm01_00154520 predicted 446
10 SASI_Mm01_00154521 predicted 1236
11 SASI_Mm01_00154522 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008245
VALIDATED
HHEX MISSION shRNA Bacterial Glycerol Stock
hematopoietically expressed homeobox
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-67s1c1
Sequence:CCGGGCCGTGGGAGTCCCGCTGTATCTCGAGATACAGCGGGACTCCCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008245.3-124s21c1
Sequence:CCGGCCTTCTACATCGACGACATCTCTCGAGAGATGTCGTCGATGTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-535s21c1
Sequence:CCGGAGCGTCTGGCCAAGATGTTACCTCGAGGTAACATCTTGGCCAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-126s1c1
Sequence:CCGGCTTCTACATCGACGACATCTTCTCGAGAAGATGTCGTCGATGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-722s1c1
Sequence:CCGGCTTTGGATCGTTCGCAGTGTTCTCGAGAACACTGCGAACGATCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-597s1c1
Sequence:CCGGCCGAGCTAAATGGAGAAGACTCTCGAGAGTCTTCTCCATTTAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-693s1c1
Sequence:CCGGCTTGCCCAGTGAACAGAATAACTCGAGTTATTCTGTTCACTGGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-1237s21c1
Sequence:CCGGGTAGCTATTCCCTCGACTTTACTCGAGTAAAGTCGAGGGAATAGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008245.3-844s21c1
Sequence:CCGGGACAGTCATCGGCCATGTTTACTCGAGTAAACATGGCCGATGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-487s21c1
Sequence:CCGGTGGAGAAGAAGTTCGAGACTCCTCGAGGAGTCTCGAACTTCTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008245
VALIDATED
HHEX MISSION shRNA shRNA Plasmid DNA
hematopoietically expressed homeobox
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-67s1c1
Sequence:CCGGGCCGTGGGAGTCCCGCTGTATCTCGAGATACAGCGGGACTCCCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008245.3-124s21c1
Sequence:CCGGCCTTCTACATCGACGACATCTCTCGAGAGATGTCGTCGATGTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-535s21c1
Sequence:CCGGAGCGTCTGGCCAAGATGTTACCTCGAGGTAACATCTTGGCCAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-126s1c1
Sequence:CCGGCTTCTACATCGACGACATCTTCTCGAGAAGATGTCGTCGATGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-722s1c1
Sequence:CCGGCTTTGGATCGTTCGCAGTGTTCTCGAGAACACTGCGAACGATCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-597s1c1
Sequence:CCGGCCGAGCTAAATGGAGAAGACTCTCGAGAGTCTTCTCCATTTAGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-693s1c1
Sequence:CCGGCTTGCCCAGTGAACAGAATAACTCGAGTTATTCTGTTCACTGGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-1237s21c1
Sequence:CCGGGTAGCTATTCCCTCGACTTTACTCGAGTAAAGTCGAGGGAATAGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008245.3-844s21c1
Sequence:CCGGGACAGTCATCGGCCATGTTTACTCGAGTAAACATGGCCGATGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-487s21c1
Sequence:CCGGTGGAGAAGAAGTTCGAGACTCCTCGAGGAGTCTCGAACTTCTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008245
VALIDATED
HHEX MISSION shRNA Lentiviral Transduction Particles
hematopoietically expressed homeobox
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-67s1c1
Sequence:CCGGGCCGTGGGAGTCCCGCTGTATCTCGAGATACAGCGGGACTCCCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008245.3-124s21c1
Sequence:CCGGCCTTCTACATCGACGACATCTCTCGAGAGATGTCGTCGATGTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-535s21c1
Sequence:CCGGAGCGTCTGGCCAAGATGTTACCTCGAGGTAACATCTTGGCCAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-126s1c1
Sequence:CCGGCTTCTACATCGACGACATCTTCTCGAGAAGATGTCGTCGATGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-722s1c1
Sequence:CCGGCTTTGGATCGTTCGCAGTGTTCTCGAGAACACTGCGAACGATCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-597s1c1
Sequence:CCGGCCGAGCTAAATGGAGAAGACTCTCGAGAGTCTTCTCCATTTAGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008245.2-693s1c1
Sequence:CCGGCTTGCCCAGTGAACAGAATAACTCGAGTTATTCTGTTCACTGGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-1237s21c1
Sequence:CCGGGTAGCTATTCCCTCGACTTTACTCGAGTAAAGTCGAGGGAATAGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008245.3-844s21c1
Sequence:CCGGGACAGTCATCGGCCATGTTTACTCGAGTAAACATGGCCGATGACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008245.3-487s21c1
Sequence:CCGGTGGAGAAGAAGTTCGAGACTCCTCGAGGAGTCTCGAACTTCTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002729
VALIDATED
HHEX MISSION shRNA Bacterial Glycerol Stock
hematopoietically expressed homeobox
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002729.2-1235s1c1
Sequence:CCGGCCCACTTAATGGAAAGGCAAACTCGAGTTTGCCTTTCCATTAAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002729.2-598s1c1
Sequence:CCGGGCGCTAAATGGAGGAGACTAACTCGAGTTAGTCTCCTCCATTTAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002729.2-762s1c1
Sequence:CCGGGAAGACCTTGAATCAGAGATTCTCGAGAATCTCTGATTCAAGGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002729.2-700s1c1
Sequence:CCGGGTGAACAGAATAAAGGTGCTTCTCGAGAAGCACCTTTATTCTGTTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-754s21c1
Sequence:CCGGTTGGATAGCTCTCAATGTTCGCTCGAGCGAACATTGAGAGCTATCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002729.4-824s21c1
Sequence:CCGGCTGATCAGGAAGTGGACATTGCTCGAGCAATGTCCACTTCCTGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-1266s21c1
Sequence:CCGGCCCACTTAATGGAAAGGCAAACTCGAGTTTGCCTTTCCATTAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-705s21c1
Sequence:CCGGCTGTGATCAGAGGCAAGATTTCTCGAGAAATCTTGCCTCTGATCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002729
VALIDATED
HHEX MISSION shRNA shRNA Plasmid DNA
hematopoietically expressed homeobox
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002729.2-1235s1c1
Sequence:CCGGCCCACTTAATGGAAAGGCAAACTCGAGTTTGCCTTTCCATTAAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002729.2-598s1c1
Sequence:CCGGGCGCTAAATGGAGGAGACTAACTCGAGTTAGTCTCCTCCATTTAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002729.2-762s1c1
Sequence:CCGGGAAGACCTTGAATCAGAGATTCTCGAGAATCTCTGATTCAAGGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002729.2-700s1c1
Sequence:CCGGGTGAACAGAATAAAGGTGCTTCTCGAGAAGCACCTTTATTCTGTTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-754s21c1
Sequence:CCGGTTGGATAGCTCTCAATGTTCGCTCGAGCGAACATTGAGAGCTATCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002729.4-824s21c1
Sequence:CCGGCTGATCAGGAAGTGGACATTGCTCGAGCAATGTCCACTTCCTGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-1266s21c1
Sequence:CCGGCCCACTTAATGGAAAGGCAAACTCGAGTTTGCCTTTCCATTAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-705s21c1
Sequence:CCGGCTGTGATCAGAGGCAAGATTTCTCGAGAAATCTTGCCTCTGATCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002729
VALIDATED
HHEX MISSION shRNA Lentiviral Transduction Particles
hematopoietically expressed homeobox
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002729.2-1235s1c1
Sequence:CCGGCCCACTTAATGGAAAGGCAAACTCGAGTTTGCCTTTCCATTAAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002729.2-598s1c1
Sequence:CCGGGCGCTAAATGGAGGAGACTAACTCGAGTTAGTCTCCTCCATTTAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002729.2-762s1c1
Sequence:CCGGGAAGACCTTGAATCAGAGATTCTCGAGAATCTCTGATTCAAGGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002729.2-700s1c1
Sequence:CCGGGTGAACAGAATAAAGGTGCTTCTCGAGAAGCACCTTTATTCTGTTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-754s21c1
Sequence:CCGGTTGGATAGCTCTCAATGTTCGCTCGAGCGAACATTGAGAGCTATCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002729.4-824s21c1
Sequence:CCGGCTGATCAGGAAGTGGACATTGCTCGAGCAATGTCCACTTCCTGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-1266s21c1
Sequence:CCGGCCCACTTAATGGAAAGGCAAACTCGAGTTTGCCTTTCCATTAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002729.4-705s21c1
Sequence:CCGGCTGTGATCAGAGGCAAGATTTCTCGAGAAATCTTGCCTCTGATCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)