EMAIL THIS PAGE TO A FRIEND

HHIP

hedgehog interacting protein

102 Gene Product Result for
Synonyms: HIP
UniProtKB ID: Q96QV1, Q6PK09, Q8NCI7, Q9BXK3, Q9H1J4, Q9H7E7
Gene ID:
Human(64399) Summary: This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
Mouse(15245) Hedgehog-interacting protein
Rat(291936) Hedgehog-interacting protein
sheep(101111396) hedgehog interacting protein
Domestic Rabbit(100344588) hedgehog interacting protein
domestic guinea pig(100728644) hedgehog interacting protein
naked mole-rat(101724427) hedgehog interacting protein
Zebrafish(326102) hedgehog interacting protein
domestic cat(101087058) hedgehog interacting protein
cow(540830) hedgehog interacting protein
Horse(100062868) hedgehog interacting protein
dog(475452) hedgehog interacting protein
chicken(422460) hedgehog interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020259 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020259 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020259 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022475 Rosetta Predictions human pricing
XM_238042 Rosetta Predictions rat pricing
NM_020259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040647 predicted 2030
2 SASI_Hs01_00040648 predicted 990
3 SASI_Hs02_00355754 predicted 1437
4 SASI_Hs01_00040649 predicted 1391
5 SASI_Hs01_00040650 predicted 1036
6 SASI_Hs01_00040652 predicted 1786
7 SASI_Hs01_00040653 predicted 1968
8 SASI_Hs01_00040654 predicted 1110
9 SASI_Hs01_00040655 predicted 1228
10 SASI_Hs02_00355755 predicted 1552
11 SASI_Hs01_00040651 predicted 1087
12 SASI_Hs01_00040656 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391176 predicted 1282
2 SASI_Rn02_00391177 predicted 1502
3 SASI_Rn02_00391178 predicted 1070
4 SASI_Rn02_00391179 predicted 2578
5 SASI_Rn02_00391180 predicted 1486
6 SASI_Rn02_00391181 predicted 1424
7 SASI_Rn02_00391182 predicted 1933
8 SASI_Rn02_00391183 predicted 2171
9 SASI_Rn02_00391184 predicted 2558
10 SASI_Rn02_00391185 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325441 predicted 2581
2 SASI_Mm01_00128620 predicted 1692
3 SASI_Mm01_00128621 predicted 2525
4 SASI_Mm01_00128622 predicted 1509
5 SASI_Mm01_00128623 predicted 1066
6 SASI_Mm02_00325442 predicted 1865
7 SASI_Mm02_00325443 predicted 2571
8 SASI_Mm02_00325444 predicted 1810
9 SASI_Mm01_00128624 predicted 1274
10 SASI_Mm01_00128626 predicted 1420
11 SASI_Mm01_00128618 predicted 2562
12 SASI_Mm01_00128619 predicted 2438
13 SASI_Mm01_00128625 predicted 496
14 SASI_Mm01_00128627 predicted 2163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022475
HHIP MISSION shRNA Bacterial Glycerol Stock
hedgehog interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022475.1-1104s21c1
Sequence:CCGGACACTTGCCGAGGCCATATTCCTCGAGGAATATGGCCTCGGCAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022475.1-1969s21c1
Sequence:CCGGTAGACATCCCACTGATATAAACTCGAGTTTATATCAGTGGGATGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-705s1c1
Sequence:CCGGGCTTCTTTGAAGGAGATGCTACTCGAGTAGCATCTCCTTCAAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2002s1c1
Sequence:CCGGGATACTGTGTTCAGACTCCAACTCGAGTTGGAGTCTGAACACAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2639s1c1
Sequence:CCGGCTTGGTCCTCAATGTGAACAACTCGAGTTGTTCACATTGAGGACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2107s1c1
Sequence:CCGGGCCATTCAGTAATGGTCCTTTCTCGAGAAAGGACCATTACTGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022475.1-2847s1c1
Sequence:CCGGCTCCTGTGATTTCATTCTCTTCTCGAGAAGAGAATGAAATCACAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022475.1-2970s1c1
Sequence:CCGGCGTTGTTGCATAACAGATGATCTCGAGATCATCTGTTATGCAACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2179s1c1
Sequence:CCGGCTACGTGTTTGGAGATCGTAACTCGAGTTACGATCTCCAAACACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022475.1-3153s21c1
Sequence:CCGGGTGCAATCCGATGGATCTAATCTCGAGATTAGATCCATCGGATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022475
HHIP MISSION shRNA shRNA Plasmid DNA
hedgehog interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022475.1-1104s21c1
Sequence:CCGGACACTTGCCGAGGCCATATTCCTCGAGGAATATGGCCTCGGCAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022475.1-1969s21c1
Sequence:CCGGTAGACATCCCACTGATATAAACTCGAGTTTATATCAGTGGGATGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-705s1c1
Sequence:CCGGGCTTCTTTGAAGGAGATGCTACTCGAGTAGCATCTCCTTCAAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2002s1c1
Sequence:CCGGGATACTGTGTTCAGACTCCAACTCGAGTTGGAGTCTGAACACAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2639s1c1
Sequence:CCGGCTTGGTCCTCAATGTGAACAACTCGAGTTGTTCACATTGAGGACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2107s1c1
Sequence:CCGGGCCATTCAGTAATGGTCCTTTCTCGAGAAAGGACCATTACTGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022475.1-2847s1c1
Sequence:CCGGCTCCTGTGATTTCATTCTCTTCTCGAGAAGAGAATGAAATCACAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022475.1-2970s1c1
Sequence:CCGGCGTTGTTGCATAACAGATGATCTCGAGATCATCTGTTATGCAACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2179s1c1
Sequence:CCGGCTACGTGTTTGGAGATCGTAACTCGAGTTACGATCTCCAAACACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022475.1-3153s21c1
Sequence:CCGGGTGCAATCCGATGGATCTAATCTCGAGATTAGATCCATCGGATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022475
HHIP MISSION shRNA Lentiviral Transduction Particles
hedgehog interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022475.1-1104s21c1
Sequence:CCGGACACTTGCCGAGGCCATATTCCTCGAGGAATATGGCCTCGGCAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022475.1-1969s21c1
Sequence:CCGGTAGACATCCCACTGATATAAACTCGAGTTTATATCAGTGGGATGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-705s1c1
Sequence:CCGGGCTTCTTTGAAGGAGATGCTACTCGAGTAGCATCTCCTTCAAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2002s1c1
Sequence:CCGGGATACTGTGTTCAGACTCCAACTCGAGTTGGAGTCTGAACACAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2639s1c1
Sequence:CCGGCTTGGTCCTCAATGTGAACAACTCGAGTTGTTCACATTGAGGACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2107s1c1
Sequence:CCGGGCCATTCAGTAATGGTCCTTTCTCGAGAAAGGACCATTACTGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022475.1-2847s1c1
Sequence:CCGGCTCCTGTGATTTCATTCTCTTCTCGAGAAGAGAATGAAATCACAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022475.1-2970s1c1
Sequence:CCGGCGTTGTTGCATAACAGATGATCTCGAGATCATCTGTTATGCAACAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022475.1-2179s1c1
Sequence:CCGGCTACGTGTTTGGAGATCGTAACTCGAGTTACGATCTCCAAACACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022475.1-3153s21c1
Sequence:CCGGGTGCAATCCGATGGATCTAATCTCGAGATTAGATCCATCGGATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020259
HHIP MISSION shRNA Bacterial Glycerol Stock
hedgehog interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020259.3-2791s1c1
Sequence:CCGGAGGTTGTATAACAGAAGGATTCTCGAGAATCCTTCTGTTATACAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-2554s1c1
Sequence:CCGGGCTGGATCTCACAAGTTACATCTCGAGATGTAACTTGTGAGATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-1336s1c1
Sequence:CCGGCCTGGCATTCCATCCCAATTACTCGAGTAATTGGGATGGAATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-2432s1c1
Sequence:CCGGCCGAACAAGTGCCTCTGTAAACTCGAGTTTACAGAGGCACTTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-854s1c1
Sequence:CCGGCCTGAAAGAGATGTCCTGGATCTCGAGATCCAGGACATCTCTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020259
HHIP MISSION shRNA shRNA Plasmid DNA
hedgehog interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020259.3-2791s1c1
Sequence:CCGGAGGTTGTATAACAGAAGGATTCTCGAGAATCCTTCTGTTATACAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-2554s1c1
Sequence:CCGGGCTGGATCTCACAAGTTACATCTCGAGATGTAACTTGTGAGATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-1336s1c1
Sequence:CCGGCCTGGCATTCCATCCCAATTACTCGAGTAATTGGGATGGAATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-2432s1c1
Sequence:CCGGCCGAACAAGTGCCTCTGTAAACTCGAGTTTACAGAGGCACTTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-854s1c1
Sequence:CCGGCCTGAAAGAGATGTCCTGGATCTCGAGATCCAGGACATCTCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020259
HHIP MISSION shRNA Lentiviral Transduction Particles
hedgehog interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020259.3-2791s1c1
Sequence:CCGGAGGTTGTATAACAGAAGGATTCTCGAGAATCCTTCTGTTATACAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-2554s1c1
Sequence:CCGGGCTGGATCTCACAAGTTACATCTCGAGATGTAACTTGTGAGATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-1336s1c1
Sequence:CCGGCCTGGCATTCCATCCCAATTACTCGAGTAATTGGGATGGAATGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-2432s1c1
Sequence:CCGGCCGAACAAGTGCCTCTGTAAACTCGAGTTTACAGAGGCACTTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020259.3-854s1c1
Sequence:CCGGCCTGAAAGAGATGTCCTGGATCTCGAGATCCAGGACATCTCTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)