EMAIL THIS PAGE TO A FRIEND

HHIPL1

HHIP-like 1

77 Gene Product Result for
Synonyms: KIAA1822 UNQ9245
UniProtKB ID: Q96JK4, A2RUF8, B2RN09, Q6UXX2
Gene ID:
Mouse(214305) hedgehog interacting protein-like 1
Rat(362781) HHIP-like 1
Zebrafish(100002738) HHIP-like 1
chicken(423448) HHIP-like 1
cow(100299504) HHIP-like 1
dog(612500) HHIP-like 1
sheep(101117368) HHIP-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032425 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001044380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001044380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001044380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127258 Rosetta Predictions human pricing
NM_032425 Rosetta Predictions human pricing
XM_001069270 Rosetta Predictions rat pricing
XM_343107 Rosetta Predictions rat pricing
NM_001044380 Rosetta Predictions mouse pricing
XM_147710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329067 predicted 1135
2 SASI_Hs02_00329068 predicted 858
3 SASI_Hs02_00329069 predicted 538
4 SASI_Hs02_00329070 predicted 957
5 SASI_Hs02_00329071 predicted 1420
6 SASI_Hs02_00329072 predicted 1435
7 SASI_Hs02_00329073 predicted 516
8 SASI_Hs02_00329074 predicted 402
9 SASI_Hs02_00329075 predicted 1527
10 SASI_Hs02_00329076 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216743 predicted 1137
2 SASI_Hs01_00216745 predicted 859
3 SASI_Hs02_00359830 predicted 532
4 SASI_Hs01_00216746 predicted 964
5 SASI_Hs01_00216748 predicted 1424
6 SASI_Hs01_00216749 predicted 1434
7 SASI_Hs02_00359831 predicted 525
8 SASI_Hs01_00216751 predicted 405
9 SASI_Hs01_00216752 predicted 1528
10 SASI_Hs02_00359832 predicted 484
11 SASI_Hs01_00216744 predicted 335
12 SASI_Hs01_00216747 predicted 311
13 SASI_Hs01_00216750 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327460 predicted 765
2 SASI_Rn02_00327461 predicted 1200
3 SASI_Rn02_00327462 predicted 725
4 SASI_Rn02_00327463 predicted 821
5 SASI_Rn02_00327464 predicted 1910
6 SASI_Rn02_00327465 predicted 1474
7 SASI_Rn02_00327466 predicted 675
8 SASI_Rn02_00327467 predicted 1741
9 SASI_Rn02_00327468 predicted 848
10 SASI_Rn02_00327469 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395333 predicted 778
2 SASI_Rn02_00395334 predicted 1263
3 SASI_Rn02_00395335 predicted 1220
4 SASI_Rn02_00395336 predicted 749
5 SASI_Rn02_00395337 predicted 839
6 SASI_Rn02_00395338 predicted 1500
7 SASI_Rn02_00395339 predicted 688
8 SASI_Rn02_00395340 predicted 529
9 SASI_Rn02_00395341 predicted 868
10 SASI_Rn02_00395342 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291234 predicted 1223
2 SASI_Mm02_00291235 predicted 932
3 SASI_Mm02_00291236 predicted 1176
4 SASI_Mm02_00291237 predicted 1532
5 SASI_Mm02_00291238 predicted 511
6 SASI_Mm02_00291239 predicted 589
7 SASI_Mm02_00291240 predicted 575
8 SASI_Mm02_00291241 predicted 1663
9 SASI_Mm02_00291242 predicted 416
10 SASI_Mm02_00291243 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_147710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259052 predicted 1256
2 SASI_Mm01_00259053 predicted 1025
3 SASI_Mm01_00259054 predicted 1692
4 SASI_Mm01_00259055 predicted 1738
5 SASI_Mm01_00259056 predicted 1149
6 SASI_Mm01_00259057 predicted 1024
7 SASI_Mm01_00259058 predicted 803
8 SASI_Mm01_00259059 predicted 3064
9 SASI_Mm01_00259060 predicted 2995
10 SASI_Mm01_00259061 predicted 1317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032425
HHIPL1 MISSION shRNA Bacterial Glycerol Stock
HHIP-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-1664s1c1
Sequence:CCGGCATCAACAACTACTACCCGTACTCGAGTACGGGTAGTAGTTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-965s1c1
Sequence:CCGGGAGGATAATCCTGGAGGTCAACTCGAGTTGACCTCCAGGATTATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-953s1c1
Sequence:CCGGCCACAGCTCTGAGAGGATAATCTCGAGATTATCCTCTCAGAGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-1437s1c1
Sequence:CCGGCTCAATGACTTGCTGCCGATTCTCGAGAATCGGCAGCAAGTCATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-1667s1c1
Sequence:CCGGCAACAACTACTACCCGTACATCTCGAGATGTACGGGTAGTAGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-1427s1c1
Sequence:CCGGCAACACCTCTCTCAATGACTTCTCGAGAAGTCATTGAGAGAGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032425.3-1988s1c1
Sequence:CCGGCCTTCACCTCACCCTCTTCAACTCGAGTTGAAGAGGGTGAGGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-398s1c1
Sequence:CCGGCCAGGATTACTGCCTGGACATCTCGAGATGTCCAGGCAGTAATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032425.4-1758s21c1
Sequence:CCGGCCACGCGGAGTTGTCTACAAACTCGAGTTTGTAGACAACTCCGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032425.4-554s21c1
Sequence:CCGGCAACAAGAACCTCAACTCAAACTCGAGTTTGAGTTGAGGTTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032425
HHIPL1 MISSION shRNA shRNA Plasmid DNA
HHIP-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-1664s1c1
Sequence:CCGGCATCAACAACTACTACCCGTACTCGAGTACGGGTAGTAGTTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-965s1c1
Sequence:CCGGGAGGATAATCCTGGAGGTCAACTCGAGTTGACCTCCAGGATTATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-953s1c1
Sequence:CCGGCCACAGCTCTGAGAGGATAATCTCGAGATTATCCTCTCAGAGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-1437s1c1
Sequence:CCGGCTCAATGACTTGCTGCCGATTCTCGAGAATCGGCAGCAAGTCATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-1667s1c1
Sequence:CCGGCAACAACTACTACCCGTACATCTCGAGATGTACGGGTAGTAGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-1427s1c1
Sequence:CCGGCAACACCTCTCTCAATGACTTCTCGAGAAGTCATTGAGAGAGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032425.3-1988s1c1
Sequence:CCGGCCTTCACCTCACCCTCTTCAACTCGAGTTGAAGAGGGTGAGGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-398s1c1
Sequence:CCGGCCAGGATTACTGCCTGGACATCTCGAGATGTCCAGGCAGTAATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032425.4-1758s21c1
Sequence:CCGGCCACGCGGAGTTGTCTACAAACTCGAGTTTGTAGACAACTCCGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032425.4-554s21c1
Sequence:CCGGCAACAAGAACCTCAACTCAAACTCGAGTTTGAGTTGAGGTTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032425
HHIPL1 MISSION shRNA Lentiviral Transduction Particles
HHIP-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-1664s1c1
Sequence:CCGGCATCAACAACTACTACCCGTACTCGAGTACGGGTAGTAGTTGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-965s1c1
Sequence:CCGGGAGGATAATCCTGGAGGTCAACTCGAGTTGACCTCCAGGATTATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-953s1c1
Sequence:CCGGCCACAGCTCTGAGAGGATAATCTCGAGATTATCCTCTCAGAGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032425.3-1437s1c1
Sequence:CCGGCTCAATGACTTGCTGCCGATTCTCGAGAATCGGCAGCAAGTCATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-1667s1c1
Sequence:CCGGCAACAACTACTACCCGTACATCTCGAGATGTACGGGTAGTAGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-1427s1c1
Sequence:CCGGCAACACCTCTCTCAATGACTTCTCGAGAAGTCATTGAGAGAGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032425.3-1988s1c1
Sequence:CCGGCCTTCACCTCACCCTCTTCAACTCGAGTTGAAGAGGGTGAGGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032425.3-398s1c1
Sequence:CCGGCCAGGATTACTGCCTGGACATCTCGAGATGTCCAGGCAGTAATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032425.4-1758s21c1
Sequence:CCGGCCACGCGGAGTTGTCTACAAACTCGAGTTTGTAGACAACTCCGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032425.4-554s21c1
Sequence:CCGGCAACAAGAACCTCAACTCAAACTCGAGTTTGAGTTGAGGTTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001044380
HHIPL1 MISSION shRNA Bacterial Glycerol Stock
HHIP-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1560s21c1
Sequence:CCGGCCCACACAAGCTGGGTAAATCCTCGAGGATTTACCCAGCTTGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-482s21c1
Sequence:CCGGCTGGCCTGTGTGAAGATTATTCTCGAGAATAATCTTCACACAGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1622s21c1
Sequence:CCGGATCTCAATGGCCTCTACATTTCTCGAGAAATGTAGAGGCCATTGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1532s21c1
Sequence:CCGGTCGATGACGTGCTGCCGATTTCTCGAGAAATCGGCAGCACGTCATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1048s21c1
Sequence:CCGGCATGGCTCAGAGAGGATAATTCTCGAGAATTATCCTCTCTGAGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001044380
HHIPL1 MISSION shRNA shRNA Plasmid DNA
HHIP-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1560s21c1
Sequence:CCGGCCCACACAAGCTGGGTAAATCCTCGAGGATTTACCCAGCTTGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-482s21c1
Sequence:CCGGCTGGCCTGTGTGAAGATTATTCTCGAGAATAATCTTCACACAGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1622s21c1
Sequence:CCGGATCTCAATGGCCTCTACATTTCTCGAGAAATGTAGAGGCCATTGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1532s21c1
Sequence:CCGGTCGATGACGTGCTGCCGATTTCTCGAGAAATCGGCAGCACGTCATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1048s21c1
Sequence:CCGGCATGGCTCAGAGAGGATAATTCTCGAGAATTATCCTCTCTGAGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001044380
HHIPL1 MISSION shRNA Lentiviral Transduction Particles
HHIP-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1560s21c1
Sequence:CCGGCCCACACAAGCTGGGTAAATCCTCGAGGATTTACCCAGCTTGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-482s21c1
Sequence:CCGGCTGGCCTGTGTGAAGATTATTCTCGAGAATAATCTTCACACAGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1622s21c1
Sequence:CCGGATCTCAATGGCCTCTACATTTCTCGAGAAATGTAGAGGCCATTGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1532s21c1
Sequence:CCGGTCGATGACGTGCTGCCGATTTCTCGAGAAATCGGCAGCACGTCATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044380.1-1048s21c1
Sequence:CCGGCATGGCTCAGAGAGGATAATTCTCGAGAATTATCCTCTCTGAGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)