EMAIL THIS PAGE TO A FRIEND

HHIPL2

HHIP-like 2

55 Gene Product Result for
Synonyms: KIAA1822L
UniProtKB ID: Q6UWX4, Q6GU65, Q96BT4, Q96BU5, Q9H8A0
Gene ID:
Mouse(78772) hedgehog interacting protein-like 2
Rat(317051) hedgehog interacting protein-like 2
sheep(101102325) HHIP-like 2
chicken(421339) HHIP-like 2
dog(478998) HHIP-like 2
cow(533766) HHIP-like 2
Horse(100055380) HHIP-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024746 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024746 Rosetta Predictions human pricing
XM_001064362 Rosetta Predictions rat pricing
XM_229754 Rosetta Predictions rat pricing
NM_030175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245482 predicted 2030
2 SASI_Hs01_00245483 predicted 1290
3 SASI_Hs02_00357231 predicted 331
4 SASI_Hs01_00245484 predicted 985
5 SASI_Hs01_00245485 predicted 996
6 SASI_Hs01_00245486 predicted 1063
7 SASI_Hs01_00245487 predicted 1623
8 SASI_Hs01_00245490 predicted 1485
9 SASI_Hs01_00245491 predicted 1944
10 SASI_Hs02_00357232 predicted 1794
11 SASI_Hs01_00245488 predicted 1602
12 SASI_Hs01_00245489 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310161 predicted 1714
2 SASI_Rn02_00310162 predicted 1180
3 SASI_Rn02_00310163 predicted 1420
4 SASI_Rn02_00310164 predicted 1727
5 SASI_Rn02_00310165 predicted 1666
6 SASI_Rn02_00310166 predicted 1132
7 SASI_Rn02_00310167 predicted 1399
8 SASI_Rn02_00310168 predicted 1053
9 SASI_Rn02_00310169 predicted 1944
10 SASI_Rn02_00310170 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386016 predicted 1707
2 SASI_Rn02_00386017 predicted 1179
3 SASI_Rn02_00386018 predicted 1422
4 SASI_Rn02_00386019 predicted 1727
5 SASI_Rn02_00386020 predicted 1665
6 SASI_Rn02_00386021 predicted 1137
7 SASI_Rn02_00386022 predicted 1391
8 SASI_Rn02_00386023 predicted 1051
9 SASI_Rn02_00386024 predicted 1947
10 SASI_Rn02_00386025 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091604 predicted 742
2 SASI_Mm01_00091605 predicted 858
3 SASI_Mm01_00091606 predicted 1242
4 SASI_Mm01_00091607 predicted 1334
5 SASI_Mm01_00091608 predicted 1229
6 SASI_Mm01_00091609 predicted 1605
7 SASI_Mm01_00091610 predicted 967
8 SASI_Mm01_00091611 predicted 1490
9 SASI_Mm01_00091612 predicted 1387
10 SASI_Mm01_00091613 predicted 1502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024746
VALIDATED
HHIPL2 MISSION shRNA Bacterial Glycerol Stock
HHIP-like 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-342s21c1
Sequence:CCGGAGCTGTGTGGAGATTACATTACTCGAGTAATGTAATCTCCACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-1551s21c1
Sequence:CCGGAGTCAGTCACTGGAGGTTATGCTCGAGCATAACCTCCAGTGACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-303s21c1
Sequence:CCGGACTGGGACATCATGGAATATTCTCGAGAATATTCCATGATGTCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-993s21c1
Sequence:CCGGCTCGGGCTGATCCTAACAAAGCTCGAGCTTTGTTAGGATCAGCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024746.3-2301s21c1
Sequence:CCGGTGCTGAATAAAGACCTTAGAACTCGAGTTCTAAGGTCTTTATTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-2220s21c1
Sequence:CCGGGAAGTCTCCCTTGACCTATTGCTCGAGCAATAGGTCAAGGGAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-2375s21c1
Sequence:CCGGATCTTGCTGTCTACTGAATAACTCGAGTTATTCAGTAGACAGCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-913s21c1
Sequence:CCGGCAATCGCAAGTTCTATATTTACTCGAGTAAATATAGAACTTGCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-1095s21c1
Sequence:CCGGTGGATGGCTATATGTACATATCTCGAGATATGTACATATAGCCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-606s21c1
Sequence:CCGGATGTCCTGAGGAACGACTATCCTCGAGGATAGTCGTTCCTCAGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024746.2-2275s1c1
Sequence:CCGGGAGCCACCTCATCAAATGAAACTCGAGTTTCATTTGATGAGGTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-967s1c1
Sequence:CCGGGATCCGAATTAGTGAGATGAACTCGAGTTCATCTCACTAATTCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1829s1c1
Sequence:CCGGCGTGGATCTATTTACAAGTTTCTCGAGAAACTTGTAAATAGATCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1609s1c1
Sequence:CCGGGTATATCTTTGGAGACTTCATCTCGAGATGAAGTCTCCAAAGATATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1514s1c1
Sequence:CCGGGTTCTGCCAATCTATGCTTATCTCGAGATAAGCATAGATTGGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1592s1c1
Sequence:CCGGCCAAATCTCAATGGCCTGTATCTCGAGATACAGGCCATTGAGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024746
VALIDATED
HHIPL2 MISSION shRNA shRNA Plasmid DNA
HHIP-like 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-342s21c1
Sequence:CCGGAGCTGTGTGGAGATTACATTACTCGAGTAATGTAATCTCCACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-1551s21c1
Sequence:CCGGAGTCAGTCACTGGAGGTTATGCTCGAGCATAACCTCCAGTGACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-303s21c1
Sequence:CCGGACTGGGACATCATGGAATATTCTCGAGAATATTCCATGATGTCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-993s21c1
Sequence:CCGGCTCGGGCTGATCCTAACAAAGCTCGAGCTTTGTTAGGATCAGCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024746.3-2301s21c1
Sequence:CCGGTGCTGAATAAAGACCTTAGAACTCGAGTTCTAAGGTCTTTATTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-2220s21c1
Sequence:CCGGGAAGTCTCCCTTGACCTATTGCTCGAGCAATAGGTCAAGGGAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-2375s21c1
Sequence:CCGGATCTTGCTGTCTACTGAATAACTCGAGTTATTCAGTAGACAGCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-913s21c1
Sequence:CCGGCAATCGCAAGTTCTATATTTACTCGAGTAAATATAGAACTTGCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-1095s21c1
Sequence:CCGGTGGATGGCTATATGTACATATCTCGAGATATGTACATATAGCCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-606s21c1
Sequence:CCGGATGTCCTGAGGAACGACTATCCTCGAGGATAGTCGTTCCTCAGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024746.2-2275s1c1
Sequence:CCGGGAGCCACCTCATCAAATGAAACTCGAGTTTCATTTGATGAGGTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-967s1c1
Sequence:CCGGGATCCGAATTAGTGAGATGAACTCGAGTTCATCTCACTAATTCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1829s1c1
Sequence:CCGGCGTGGATCTATTTACAAGTTTCTCGAGAAACTTGTAAATAGATCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1609s1c1
Sequence:CCGGGTATATCTTTGGAGACTTCATCTCGAGATGAAGTCTCCAAAGATATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1514s1c1
Sequence:CCGGGTTCTGCCAATCTATGCTTATCTCGAGATAAGCATAGATTGGCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1592s1c1
Sequence:CCGGCCAAATCTCAATGGCCTGTATCTCGAGATACAGGCCATTGAGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024746
VALIDATED
HHIPL2 MISSION shRNA Lentiviral Transduction Particles
HHIP-like 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-342s21c1
Sequence:CCGGAGCTGTGTGGAGATTACATTACTCGAGTAATGTAATCTCCACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-1551s21c1
Sequence:CCGGAGTCAGTCACTGGAGGTTATGCTCGAGCATAACCTCCAGTGACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-303s21c1
Sequence:CCGGACTGGGACATCATGGAATATTCTCGAGAATATTCCATGATGTCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-993s21c1
Sequence:CCGGCTCGGGCTGATCCTAACAAAGCTCGAGCTTTGTTAGGATCAGCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024746.3-2301s21c1
Sequence:CCGGTGCTGAATAAAGACCTTAGAACTCGAGTTCTAAGGTCTTTATTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-2220s21c1
Sequence:CCGGGAAGTCTCCCTTGACCTATTGCTCGAGCAATAGGTCAAGGGAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-2375s21c1
Sequence:CCGGATCTTGCTGTCTACTGAATAACTCGAGTTATTCAGTAGACAGCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-913s21c1
Sequence:CCGGCAATCGCAAGTTCTATATTTACTCGAGTAAATATAGAACTTGCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024746.3-1095s21c1
Sequence:CCGGTGGATGGCTATATGTACATATCTCGAGATATGTACATATAGCCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024746.3-606s21c1
Sequence:CCGGATGTCCTGAGGAACGACTATCCTCGAGGATAGTCGTTCCTCAGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024746.2-2275s1c1
Sequence:CCGGGAGCCACCTCATCAAATGAAACTCGAGTTTCATTTGATGAGGTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-967s1c1
Sequence:CCGGGATCCGAATTAGTGAGATGAACTCGAGTTCATCTCACTAATTCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1829s1c1
Sequence:CCGGCGTGGATCTATTTACAAGTTTCTCGAGAAACTTGTAAATAGATCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1609s1c1
Sequence:CCGGGTATATCTTTGGAGACTTCATCTCGAGATGAAGTCTCCAAAGATATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1514s1c1
Sequence:CCGGGTTCTGCCAATCTATGCTTATCTCGAGATAAGCATAGATTGGCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024746.2-1592s1c1
Sequence:CCGGCCAAATCTCAATGGCCTGTATCTCGAGATACAGGCCATTGAGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030175
HHIPL2 MISSION shRNA Bacterial Glycerol Stock
HHIP-like 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030175.2-1245s1c1
Sequence:CCGGGACAAGAGACTTTGCCGTAATCTCGAGATTACGGCAAAGTCTCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030175.1-2126s1c1
Sequence:CCGGCCTGGGAAATCTTGCTGTCTACTCGAGTAGACAGCAAGATTTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-1766s1c1
Sequence:CCGGCCAACGCAACCTTCACTTCTACTCGAGTAGAAGTGAAGGTTGCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-1590s1c1
Sequence:CCGGGCCACATGGATCTATTTACAACTCGAGTTGTAAATAGATCCATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030175.1-2131s1c1
Sequence:CCGGGAAATCTTGCTGTCTACTGAACTCGAGTTCAGTAGACAGCAAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-681s1c1
Sequence:CCGGCAACCGCAAGTTCTACATTTACTCGAGTAAATGTAGAACTTGCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030175.1-2034s1c1
Sequence:CCGGGAGTGCATAATGCTGTCCATTCTCGAGAATGGACAGCATTATGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030175
HHIPL2 MISSION shRNA shRNA Plasmid DNA
HHIP-like 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030175.2-1245s1c1
Sequence:CCGGGACAAGAGACTTTGCCGTAATCTCGAGATTACGGCAAAGTCTCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030175.1-2126s1c1
Sequence:CCGGCCTGGGAAATCTTGCTGTCTACTCGAGTAGACAGCAAGATTTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-1766s1c1
Sequence:CCGGCCAACGCAACCTTCACTTCTACTCGAGTAGAAGTGAAGGTTGCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-1590s1c1
Sequence:CCGGGCCACATGGATCTATTTACAACTCGAGTTGTAAATAGATCCATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030175.1-2131s1c1
Sequence:CCGGGAAATCTTGCTGTCTACTGAACTCGAGTTCAGTAGACAGCAAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-681s1c1
Sequence:CCGGCAACCGCAAGTTCTACATTTACTCGAGTAAATGTAGAACTTGCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030175.1-2034s1c1
Sequence:CCGGGAGTGCATAATGCTGTCCATTCTCGAGAATGGACAGCATTATGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030175
HHIPL2 MISSION shRNA Lentiviral Transduction Particles
HHIP-like 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030175.2-1245s1c1
Sequence:CCGGGACAAGAGACTTTGCCGTAATCTCGAGATTACGGCAAAGTCTCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030175.1-2126s1c1
Sequence:CCGGCCTGGGAAATCTTGCTGTCTACTCGAGTAGACAGCAAGATTTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-1766s1c1
Sequence:CCGGCCAACGCAACCTTCACTTCTACTCGAGTAGAAGTGAAGGTTGCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-1590s1c1
Sequence:CCGGGCCACATGGATCTATTTACAACTCGAGTTGTAAATAGATCCATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030175.1-2131s1c1
Sequence:CCGGGAAATCTTGCTGTCTACTGAACTCGAGTTCAGTAGACAGCAAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030175.1-681s1c1
Sequence:CCGGCAACCGCAAGTTCTACATTTACTCGAGTAAATGTAGAACTTGCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030175.1-2034s1c1
Sequence:CCGGGAGTGCATAATGCTGTCCATTCTCGAGAATGGACAGCATTATGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)