EMAIL THIS PAGE TO A FRIEND

HHLA1

HERV-H LTR-associating 1

69 Gene Product Result for
Synonyms: PLA2L
UniProtKB ID: C9JL84
Gene ID:
Mouse(654498) HERV-H LTR-associating 1
chicken(101669155) HERV-H LTR-associating 1
chicken(101749300) HERV-H LTR-associating 1
cow(101905983) HERV-H LTR-associating 1
domestic cat(101087813) HERV-H LTR-associating 1
domestic guinea pig(101787447) HERV-H LTR-associating 1
naked mole-rat(101719782) HERV-H LTR-associating 1
sheep(101120927) HERV-H LTR-associating 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184671 MISSION® esiRNA esiRNA targeting mouse Hhla1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005712 Rosetta Predictions human pricing
XR_040231 Rosetta Predictions human pricing
XR_040232 Rosetta Predictions human pricing
XR_040233 Rosetta Predictions human pricing
XR_035229 Rosetta Predictions mouse pricing
XR_035264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116530 predicted 1932
2 SASI_Hs01_00116531 predicted 1098
3 SASI_Hs01_00116532 predicted 1415
4 SASI_Hs01_00116533 predicted 1866
5 SASI_Hs01_00116534 predicted 1863
6 SASI_Hs01_00116535 predicted 1560
7 SASI_Hs01_00116536 predicted 1105
8 SASI_Hs01_00116537 predicted 1903
9 SASI_Hs01_00116538 predicted 1865
10 SASI_Hs01_00116539 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517081 predicted 447
2 SASI_Hs02_00517082 predicted 505
3 SASI_Hs02_00517083 predicted 582
4 SASI_Hs02_00517084 predicted 700
5 SASI_Hs02_00517085 predicted 444
6 SASI_Hs02_00517086 predicted 581
7 SASI_Hs02_00517087 predicted 666
8 SASI_Hs02_00517088 predicted 288
9 SASI_Hs02_00517089 predicted 466
10 SASI_Hs02_00517090 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517091 predicted 568
2 SASI_Hs02_00517092 predicted 501
3 SASI_Hs02_00517093 predicted 643
4 SASI_Hs02_00517094 predicted 759
5 SASI_Hs02_00517095 predicted 500
6 SASI_Hs02_00517096 predicted 638
7 SASI_Hs02_00517097 predicted 723
8 SASI_Hs02_00517098 predicted 341
9 SASI_Hs02_00517099 predicted 525
10 SASI_Hs02_00517100 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517101 predicted 505
2 SASI_Hs02_00517102 predicted 441
3 SASI_Hs02_00517103 predicted 588
4 SASI_Hs02_00517104 predicted 698
5 SASI_Hs02_00517105 predicted 445
6 SASI_Hs02_00517106 predicted 576
7 SASI_Hs02_00517107 predicted 666
8 SASI_Hs02_00517108 predicted 281
9 SASI_Hs02_00517109 predicted 468
10 SASI_Hs02_00517110 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480733 predicted 1865
2 SASI_Mm02_00480734 predicted 609
3 SASI_Mm02_00480735 predicted 564
4 SASI_Mm02_00480736 predicted 422
5 SASI_Mm02_00480737 predicted 897
6 SASI_Mm02_00480738 predicted 413
7 SASI_Mm02_00480739 predicted 1799
8 SASI_Mm02_00480740 predicted 1157
9 SASI_Mm02_00480741 predicted 368
10 SASI_Mm02_00480742 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481078 predicted 1867
2 SASI_Mm02_00481079 predicted 609
3 SASI_Mm02_00481080 predicted 565
4 SASI_Mm02_00481081 predicted 422
5 SASI_Mm02_00481082 predicted 897
6 SASI_Mm02_00481083 predicted 404
7 SASI_Mm02_00481084 predicted 1793
8 SASI_Mm02_00481085 predicted 1152
9 SASI_Mm02_00481086 predicted 369
10 SASI_Mm02_00481087 predicted 1937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005712
HHLA1 MISSION shRNA Bacterial Glycerol Stock
HERV-H LTR-associating 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1931s1c1
Sequence:CCGGGACATGAGATACTGTCTTGAACTCGAGTTCAAGACAGTATCTCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1007s1c1
Sequence:CCGGCATAGCAAATGCCTGATACTTCTCGAGAAGTATCAGGCATTTGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1037s1c1
Sequence:CCGGGAAAGGTTTGAATCTCCACATCTCGAGATGTGGAGATTCAAACCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-989s1c1
Sequence:CCGGCAGAATCTGTTCAGGAAACATCTCGAGATGTTTCCTGAACAGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1928s1c1
Sequence:CCGGGAGGACATGAGATACTGTCTTCTCGAGAAGACAGTATCTCATGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1703s1c1
Sequence:CCGGCAAACAGGTGATCTCTCTGCACTCGAGTGCAGAGAGATCACCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1069s1c1
Sequence:CCGGCAGTCCAGTGACCTTTCAGTTCTCGAGAACTGAAAGGTCACTGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1879s1c1
Sequence:CCGGCCAATTCTTCCAGCAATGCCTCTCGAGAGGCATTGCTGGAAGAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1557s1c1
Sequence:CCGGCCATGAACACTACAAGCCTTTCTCGAGAAAGGCTTGTAGTGTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1772s1c1
Sequence:CCGGCATCAAGTTTCAAGGTGTCCTCTCGAGAGGACACCTTGAAACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005712
HHLA1 MISSION shRNA shRNA Plasmid DNA
HERV-H LTR-associating 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1931s1c1
Sequence:CCGGGACATGAGATACTGTCTTGAACTCGAGTTCAAGACAGTATCTCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1007s1c1
Sequence:CCGGCATAGCAAATGCCTGATACTTCTCGAGAAGTATCAGGCATTTGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1037s1c1
Sequence:CCGGGAAAGGTTTGAATCTCCACATCTCGAGATGTGGAGATTCAAACCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-989s1c1
Sequence:CCGGCAGAATCTGTTCAGGAAACATCTCGAGATGTTTCCTGAACAGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1928s1c1
Sequence:CCGGGAGGACATGAGATACTGTCTTCTCGAGAAGACAGTATCTCATGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1703s1c1
Sequence:CCGGCAAACAGGTGATCTCTCTGCACTCGAGTGCAGAGAGATCACCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1069s1c1
Sequence:CCGGCAGTCCAGTGACCTTTCAGTTCTCGAGAACTGAAAGGTCACTGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1879s1c1
Sequence:CCGGCCAATTCTTCCAGCAATGCCTCTCGAGAGGCATTGCTGGAAGAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1557s1c1
Sequence:CCGGCCATGAACACTACAAGCCTTTCTCGAGAAAGGCTTGTAGTGTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1772s1c1
Sequence:CCGGCATCAAGTTTCAAGGTGTCCTCTCGAGAGGACACCTTGAAACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005712
HHLA1 MISSION shRNA Lentiviral Transduction Particles
HERV-H LTR-associating 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1931s1c1
Sequence:CCGGGACATGAGATACTGTCTTGAACTCGAGTTCAAGACAGTATCTCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1007s1c1
Sequence:CCGGCATAGCAAATGCCTGATACTTCTCGAGAAGTATCAGGCATTTGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1037s1c1
Sequence:CCGGGAAAGGTTTGAATCTCCACATCTCGAGATGTGGAGATTCAAACCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-989s1c1
Sequence:CCGGCAGAATCTGTTCAGGAAACATCTCGAGATGTTTCCTGAACAGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1928s1c1
Sequence:CCGGGAGGACATGAGATACTGTCTTCTCGAGAAGACAGTATCTCATGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1703s1c1
Sequence:CCGGCAAACAGGTGATCTCTCTGCACTCGAGTGCAGAGAGATCACCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1069s1c1
Sequence:CCGGCAGTCCAGTGACCTTTCAGTTCTCGAGAACTGAAAGGTCACTGGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1879s1c1
Sequence:CCGGCCAATTCTTCCAGCAATGCCTCTCGAGAGGCATTGCTGGAAGAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005712.1-1557s1c1
Sequence:CCGGCCATGAACACTACAAGCCTTTCTCGAGAAAGGCTTGTAGTGTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005712.1-1772s1c1
Sequence:CCGGCATCAAGTTTCAAGGTGTCCTCTCGAGAGGACACCTTGAAACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145096
HHLA1 MISSION shRNA Bacterial Glycerol Stock
HERV-H LTR-associating 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-858s21c1
Sequence:CCGGGTCACTTCTAAGACCATATTCCTCGAGGAATATGGTCTTAGAAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-378s21c1
Sequence:CCGGTGTGAATGGCATGCTCAATAGCTCGAGCTATTGAGCATGCCATTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-417s21c1
Sequence:CCGGGCAATTCTTCTCCGTACTTAGCTCGAGCTAAGTACGGAGAAGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-476s21c1
Sequence:CCGGCCGTGGCCATCTACAACATTTCTCGAGAAATGTTGTAGATGGCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145096.1-1736s21c1
Sequence:CCGGCAAGTCTCAGGGTTATCATAACTCGAGTTATGATAACCCTGAGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145096
HHLA1 MISSION shRNA shRNA Plasmid DNA
HERV-H LTR-associating 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-858s21c1
Sequence:CCGGGTCACTTCTAAGACCATATTCCTCGAGGAATATGGTCTTAGAAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-378s21c1
Sequence:CCGGTGTGAATGGCATGCTCAATAGCTCGAGCTATTGAGCATGCCATTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-417s21c1
Sequence:CCGGGCAATTCTTCTCCGTACTTAGCTCGAGCTAAGTACGGAGAAGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-476s21c1
Sequence:CCGGCCGTGGCCATCTACAACATTTCTCGAGAAATGTTGTAGATGGCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145096.1-1736s21c1
Sequence:CCGGCAAGTCTCAGGGTTATCATAACTCGAGTTATGATAACCCTGAGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145096
HHLA1 MISSION shRNA Lentiviral Transduction Particles
HERV-H LTR-associating 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-858s21c1
Sequence:CCGGGTCACTTCTAAGACCATATTCCTCGAGGAATATGGTCTTAGAAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-378s21c1
Sequence:CCGGTGTGAATGGCATGCTCAATAGCTCGAGCTATTGAGCATGCCATTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-417s21c1
Sequence:CCGGGCAATTCTTCTCCGTACTTAGCTCGAGCTAAGTACGGAGAAGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145096.1-476s21c1
Sequence:CCGGCCGTGGCCATCTACAACATTTCTCGAGAAATGTTGTAGATGGCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145096.1-1736s21c1
Sequence:CCGGCAAGTCTCAGGGTTATCATAACTCGAGTTATGATAACCCTGAGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)