EMAIL THIS PAGE TO A FRIEND

HHLA3

HERV-H LTR-associating 3

47 Gene Product Result for
Species: Human HHLA3(11147)
UniProtKB ID: Q9XRX5, D3DQ74, Q5VZP2, Q96FH5, Q9XRX4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031693 Rosetta Predictions human pricing
NM_001036645 Rosetta Predictions human pricing
NM_001036646 Rosetta Predictions human pricing
NM_007071 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059436 predicted 157
2 SASI_Hs01_00059437 predicted 210
3 SASI_Hs01_00059438 predicted 219
4 SASI_Hs01_00059439 predicted 150
5 SASI_Hs01_00059440 predicted 163
6 SASI_Hs01_00059441 predicted 179
7 SASI_Hs01_00059442 predicted 184
8 SASI_Hs01_00059443 predicted 151
9 SASI_Hs01_00059444 predicted 210
10 SASI_Hs01_00059445 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001036645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170709 predicted 355
2 SASI_Hs01_00170710 predicted 162
3 SASI_Hs01_00170711 predicted 215
4 SASI_Hs01_00170712 predicted 220
5 SASI_Hs01_00170713 predicted 164
6 SASI_Hs01_00170714 predicted 179
7 SASI_Hs01_00170715 predicted 183
8 SASI_Hs02_00308209 predicted 143
9 SASI_Hs01_00170716 predicted 331
10 SASI_Hs01_00170718 predicted 218
11 SASI_Hs01_00170717 predicted 143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001036646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135048 predicted 162
2 SASI_Hs01_00135049 predicted 216
3 SASI_Hs01_00135050 predicted 223
4 SASI_Hs01_00135051 predicted 141
5 SASI_Hs01_00135052 predicted 167
6 SASI_Hs01_00135053 predicted 180
7 SASI_Hs01_00135054 predicted 183
8 SASI_Hs01_00135055 predicted 146
9 SASI_Hs01_00135056 predicted 218
10 SASI_Hs01_00135057 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236051 predicted 157
2 SASI_Hs01_00236052 predicted 215
3 SASI_Hs01_00236053 predicted 219
4 SASI_Hs01_00236054 predicted 143
5 SASI_Hs01_00236055 predicted 165
6 SASI_Hs01_00236056 predicted 180
7 SASI_Hs01_00236057 predicted 182
8 SASI_Hs01_00236058 predicted 146
9 SASI_Hs01_00236059 predicted 218
10 SASI_Hs01_00236060 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007071
VALIDATED
HHLA3 MISSION shRNA Bacterial Glycerol Stock
HERV-H LTR-associating 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007071.1-237s1c1
Sequence:CCGGGATACTCAGTCAACCAACATTCTCGAGAATGTTGGTTGACTGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-257s21c1
Sequence:CCGGATACTCAGTCAACCAACATTTCTCGAGAAATGTTGGTTGACTGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-337s21c1
Sequence:CCGGGAGAGCATTCTTGGATCTCTTCTCGAGAAGAGATCCAAGAATGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-295s21c1
Sequence:CCGGTGCCGTCTTGTCAACGGAAAGCTCGAGCTTTCCGTTGACAAGACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007071.2-395s21c1
Sequence:CCGGAGGCAAGTTACTTCTATATAGCTCGAGCTATATAGAAGTAACTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-372s21c1
Sequence:CCGGGAGGCGAATCCATAGAGTAAGCTCGAGCTTACTCTATGGATTCGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007071
VALIDATED
HHLA3 MISSION shRNA shRNA Plasmid DNA
HERV-H LTR-associating 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007071.1-237s1c1
Sequence:CCGGGATACTCAGTCAACCAACATTCTCGAGAATGTTGGTTGACTGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-257s21c1
Sequence:CCGGATACTCAGTCAACCAACATTTCTCGAGAAATGTTGGTTGACTGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-337s21c1
Sequence:CCGGGAGAGCATTCTTGGATCTCTTCTCGAGAAGAGATCCAAGAATGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-295s21c1
Sequence:CCGGTGCCGTCTTGTCAACGGAAAGCTCGAGCTTTCCGTTGACAAGACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007071.2-395s21c1
Sequence:CCGGAGGCAAGTTACTTCTATATAGCTCGAGCTATATAGAAGTAACTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-372s21c1
Sequence:CCGGGAGGCGAATCCATAGAGTAAGCTCGAGCTTACTCTATGGATTCGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007071
VALIDATED
HHLA3 MISSION shRNA Lentiviral Transduction Particles
HERV-H LTR-associating 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007071.1-237s1c1
Sequence:CCGGGATACTCAGTCAACCAACATTCTCGAGAATGTTGGTTGACTGAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-257s21c1
Sequence:CCGGATACTCAGTCAACCAACATTTCTCGAGAAATGTTGGTTGACTGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-337s21c1
Sequence:CCGGGAGAGCATTCTTGGATCTCTTCTCGAGAAGAGATCCAAGAATGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-295s21c1
Sequence:CCGGTGCCGTCTTGTCAACGGAAAGCTCGAGCTTTCCGTTGACAAGACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007071.2-395s21c1
Sequence:CCGGAGGCAAGTTACTTCTATATAGCTCGAGCTATATAGAAGTAACTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007071.2-372s21c1
Sequence:CCGGGAGGCGAATCCATAGAGTAAGCTCGAGCTTACTCTATGGATTCGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)