EMAIL THIS PAGE TO A FRIEND

HIAT1

hippocampus abundant transcript 1

129 Gene Product Result for
UniProtKB ID: Q96MC6, Q6P2N7, Q8N8K2, Q8NBV3, Q96NY0, Q9NT25
Gene ID:
Mouse(15247) hippocampus abundant gene transcript 1
Rat(100134827) hippocampus abundant transcript 1
chicken(429081) hippocampus abundant transcript 1
domestic cat(101089882) hippocampus abundant transcript 1
cow(516584) hippocampus abundant transcript 1
dog(490143) hippocampus abundant transcript 1
sheep(101112360) hippocampus abundant transcript 1
domestic guinea pig(100721573) hippocampus abundant transcript 1
naked mole-rat(101720417) hippocampus abundant transcript 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033055 Rosetta Predictions human pricing
NM_001106467 Rosetta Predictions rat pricing
NM_008246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117308 predicted 1515
2 SASI_Hs01_00117309 predicted 533
3 SASI_Hs01_00117310 predicted 374
4 SASI_Hs01_00117311 predicted 219
5 SASI_Hs01_00117312 predicted 228
6 SASI_Hs01_00117313 predicted 1120
7 SASI_Hs01_00117315 predicted 1554
8 SASI_Hs02_00360748 predicted 207
9 SASI_Hs01_00117316 predicted 452
10 SASI_Hs01_00117317 predicted 1496
11 SASI_Hs01_00117314 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219248 predicted 1564
2 SASI_Rn02_00219249 predicted 1458
3 SASI_Rn02_00219250 predicted 553
4 SASI_Rn02_00219251 predicted 1460
5 SASI_Rn02_00219252 predicted 1553
6 SASI_Rn02_00219253 predicted 310
7 SASI_Rn02_00219254 predicted 1201
8 SASI_Rn02_00219255 predicted 352
9 SASI_Rn02_00219256 predicted 484
10 SASI_Rn02_00219257 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093021 predicted 446
2 SASI_Mm01_00093022 predicted 1418
3 SASI_Mm01_00093023 predicted 946
4 SASI_Mm01_00093024 predicted 1163
5 SASI_Mm01_00093025 predicted 869
6 SASI_Mm01_00093026 predicted 1513
7 SASI_Mm01_00093027 predicted 653
8 SASI_Mm01_00093028 predicted 283
9 SASI_Mm01_00093029 predicted 598
10 SASI_Mm01_00093030 predicted 1509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033055
VALIDATED
HIAT1 MISSION shRNA Bacterial Glycerol Stock
hippocampus abundant transcript 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-905s21c1
Sequence:CCGGGTTTACTTATGAGGTCAATTGCTCGAGCAATTGACCTCATAAGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-805s21c1
Sequence:CCGGTTATACCTCAGACAGATAATGCTCGAGCATTATCTGTCTGAGGTATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033055.2-1680s21c1
Sequence:CCGGTTGTTTATTAGCACCAATTTCCTCGAGGAAATTGGTGCTAATAAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-586s21c1
Sequence:CCGGGCAATAGCTTTGCTAGATATTCTCGAGAATATCTAGCAAAGCTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-535s21c1
Sequence:CCGGGCTTATCTTGGACGAGTATATCTCGAGATATACTCGTCCAAGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033055.2-1551s21c1
Sequence:CCGGTCCATCCACAGTGTACTTTAACTCGAGTTAAAGTACACTGTGGATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-1157s1c1
Sequence:CCGGCGGCCCTCTATGGATTCATTTCTCGAGAAATGAATCCATAGAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-169s1c1
Sequence:CCGGCCCACCTTGGTGGTATTACATCTCGAGATGTAATACCACCAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033055.2-1333s1c1
Sequence:CCGGGCCTTGTTTATTCCGGAACATCTCGAGATGTTCCGGAATAAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033055.2-222s1c1
Sequence:CCGGCGGCTTAATTCAAGGAGTAAACTCGAGTTTACTCCTTGAATTAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-847s1c1
Sequence:CCGGGCAGCGTTTATAGCAGTCCTTCTCGAGAAGGACTGCTATAAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033055
VALIDATED
HIAT1 MISSION shRNA shRNA Plasmid DNA
hippocampus abundant transcript 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-905s21c1
Sequence:CCGGGTTTACTTATGAGGTCAATTGCTCGAGCAATTGACCTCATAAGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-805s21c1
Sequence:CCGGTTATACCTCAGACAGATAATGCTCGAGCATTATCTGTCTGAGGTATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033055.2-1680s21c1
Sequence:CCGGTTGTTTATTAGCACCAATTTCCTCGAGGAAATTGGTGCTAATAAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-586s21c1
Sequence:CCGGGCAATAGCTTTGCTAGATATTCTCGAGAATATCTAGCAAAGCTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-535s21c1
Sequence:CCGGGCTTATCTTGGACGAGTATATCTCGAGATATACTCGTCCAAGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033055.2-1551s21c1
Sequence:CCGGTCCATCCACAGTGTACTTTAACTCGAGTTAAAGTACACTGTGGATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-1157s1c1
Sequence:CCGGCGGCCCTCTATGGATTCATTTCTCGAGAAATGAATCCATAGAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-169s1c1
Sequence:CCGGCCCACCTTGGTGGTATTACATCTCGAGATGTAATACCACCAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033055.2-1333s1c1
Sequence:CCGGGCCTTGTTTATTCCGGAACATCTCGAGATGTTCCGGAATAAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033055.2-222s1c1
Sequence:CCGGCGGCTTAATTCAAGGAGTAAACTCGAGTTTACTCCTTGAATTAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-847s1c1
Sequence:CCGGGCAGCGTTTATAGCAGTCCTTCTCGAGAAGGACTGCTATAAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033055
VALIDATED
HIAT1 MISSION shRNA Lentiviral Transduction Particles
hippocampus abundant transcript 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-905s21c1
Sequence:CCGGGTTTACTTATGAGGTCAATTGCTCGAGCAATTGACCTCATAAGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-805s21c1
Sequence:CCGGTTATACCTCAGACAGATAATGCTCGAGCATTATCTGTCTGAGGTATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033055.2-1680s21c1
Sequence:CCGGTTGTTTATTAGCACCAATTTCCTCGAGGAAATTGGTGCTAATAAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-586s21c1
Sequence:CCGGGCAATAGCTTTGCTAGATATTCTCGAGAATATCTAGCAAAGCTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033055.2-535s21c1
Sequence:CCGGGCTTATCTTGGACGAGTATATCTCGAGATATACTCGTCCAAGATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033055.2-1551s21c1
Sequence:CCGGTCCATCCACAGTGTACTTTAACTCGAGTTAAAGTACACTGTGGATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-1157s1c1
Sequence:CCGGCGGCCCTCTATGGATTCATTTCTCGAGAAATGAATCCATAGAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-169s1c1
Sequence:CCGGCCCACCTTGGTGGTATTACATCTCGAGATGTAATACCACCAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033055.2-1333s1c1
Sequence:CCGGGCCTTGTTTATTCCGGAACATCTCGAGATGTTCCGGAATAAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033055.2-222s1c1
Sequence:CCGGCGGCTTAATTCAAGGAGTAAACTCGAGTTTACTCCTTGAATTAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033055.2-847s1c1
Sequence:CCGGGCAGCGTTTATAGCAGTCCTTCTCGAGAAGGACTGCTATAAACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008246
HIAT1 MISSION shRNA Bacterial Glycerol Stock
hippocampus abundant transcript 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-936s21c1
Sequence:CCGGCCTTGGCATTCTGTCCATTATCTCGAGATAATGGACAGAATGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008246.1-2231s21c1
Sequence:CCGGCCTCAACACTTGAATACATAACTCGAGTTATGTATTCAAGTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-813s21c1
Sequence:CCGGGCTGATCTGTATCACGGTGTTCTCGAGAACACCGTGATACAGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-1418s21c1
Sequence:CCGGCGGAACACACTAATTTAAGTTCTCGAGAACTTAAATTAGTGTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-270s21c1
Sequence:CCGGCCCTAAACATACATTTCTGATCTCGAGATCAGAAATGTATGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-1418s1c1
Sequence:CCGGCGGAACACACTAATTTAAGTTCTCGAGAACTTAAATTAGTGTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-813s1c1
Sequence:CCGGGCTGATCTGTATCACGGTGTTCTCGAGAACACCGTGATACAGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-936s1c1
Sequence:CCGGCCTTGGCATTCTGTCCATTATCTCGAGATAATGGACAGAATGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008246.1-2231s1c1
Sequence:CCGGCCTCAACACTTGAATACATAACTCGAGTTATGTATTCAAGTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-270s1c1
Sequence:CCGGCCCTAAACATACATTTCTGATCTCGAGATCAGAAATGTATGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008246
HIAT1 MISSION shRNA shRNA Plasmid DNA
hippocampus abundant transcript 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-936s21c1
Sequence:CCGGCCTTGGCATTCTGTCCATTATCTCGAGATAATGGACAGAATGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008246.1-2231s21c1
Sequence:CCGGCCTCAACACTTGAATACATAACTCGAGTTATGTATTCAAGTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-813s21c1
Sequence:CCGGGCTGATCTGTATCACGGTGTTCTCGAGAACACCGTGATACAGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-1418s21c1
Sequence:CCGGCGGAACACACTAATTTAAGTTCTCGAGAACTTAAATTAGTGTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-270s21c1
Sequence:CCGGCCCTAAACATACATTTCTGATCTCGAGATCAGAAATGTATGTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-1418s1c1
Sequence:CCGGCGGAACACACTAATTTAAGTTCTCGAGAACTTAAATTAGTGTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-813s1c1
Sequence:CCGGGCTGATCTGTATCACGGTGTTCTCGAGAACACCGTGATACAGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-936s1c1
Sequence:CCGGCCTTGGCATTCTGTCCATTATCTCGAGATAATGGACAGAATGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008246.1-2231s1c1
Sequence:CCGGCCTCAACACTTGAATACATAACTCGAGTTATGTATTCAAGTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-270s1c1
Sequence:CCGGCCCTAAACATACATTTCTGATCTCGAGATCAGAAATGTATGTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008246
HIAT1 MISSION shRNA Lentiviral Transduction Particles
hippocampus abundant transcript 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-936s21c1
Sequence:CCGGCCTTGGCATTCTGTCCATTATCTCGAGATAATGGACAGAATGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008246.1-2231s21c1
Sequence:CCGGCCTCAACACTTGAATACATAACTCGAGTTATGTATTCAAGTGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-813s21c1
Sequence:CCGGGCTGATCTGTATCACGGTGTTCTCGAGAACACCGTGATACAGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-1418s21c1
Sequence:CCGGCGGAACACACTAATTTAAGTTCTCGAGAACTTAAATTAGTGTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008246.1-270s21c1
Sequence:CCGGCCCTAAACATACATTTCTGATCTCGAGATCAGAAATGTATGTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-1418s1c1
Sequence:CCGGCGGAACACACTAATTTAAGTTCTCGAGAACTTAAATTAGTGTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-813s1c1
Sequence:CCGGGCTGATCTGTATCACGGTGTTCTCGAGAACACCGTGATACAGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-936s1c1
Sequence:CCGGCCTTGGCATTCTGTCCATTATCTCGAGATAATGGACAGAATGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008246.1-2231s1c1
Sequence:CCGGCCTCAACACTTGAATACATAACTCGAGTTATGTATTCAAGTGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008246.1-270s1c1
Sequence:CCGGCCCTAAACATACATTTCTGATCTCGAGATCAGAAATGTATGTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)