EMAIL THIS PAGE TO A FRIEND

HIATL1

hippocampus abundant transcript-like 1

115 Gene Product Result for
UniProtKB ID: Q5SR56, Q3KQT4, Q53GU5, Q8WU95, Q96SM4
Gene ID:
Mouse(66631) hippocampus abundant transcript-like 1
Rat(306687) hippocampus abundant transcript-like 1
domestic cat(101081935) hippocampus abundant transcript-like 1
cow(510635) hippocampus abundant transcript-like 1
domestic guinea pig(100725832) hippocampus abundant transcript-like 1
naked mole-rat(101716467) hippocampus abundant transcript-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096481 MISSION® esiRNA esiRNA human HIATL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032558 Rosetta Predictions human pricing
NM_001107334 Rosetta Predictions rat pricing
NM_001083901 Rosetta Predictions mouse pricing
NM_133680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213243 predicted 500
2 SASI_Hs01_00213244 predicted 1569
3 SASI_Hs01_00213246 predicted 1417
4 SASI_Hs01_00213247 predicted 1017
5 SASI_Hs01_00213248 predicted 1596
6 SASI_Hs01_00213249 predicted 899
7 SASI_Hs01_00213250 predicted 991
8 SASI_Hs02_00360068 predicted 1601
9 SASI_Hs01_00213252 predicted 1013
10 SASI_Hs02_00360069 predicted 825
11 SASI_Hs01_00213245 predicted 513
12 SASI_Hs01_00213251 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227815 predicted 910
2 SASI_Rn02_00227816 predicted 593
3 SASI_Rn02_00227817 predicted 597
4 SASI_Rn02_00227818 predicted 1185
5 SASI_Rn02_00227819 predicted 737
6 SASI_Rn02_00227820 predicted 1130
7 SASI_Rn02_00227821 predicted 1582
8 SASI_Rn02_00227822 predicted 843
9 SASI_Rn02_00227823 predicted 615
10 SASI_Rn02_00227824 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299901 predicted 653
2 SASI_Mm02_00299902 predicted 1044
3 SASI_Mm02_00299903 predicted 1576
4 SASI_Mm02_00299904 predicted 1452
5 SASI_Mm02_00299905 predicted 498
6 SASI_Mm02_00299906 predicted 1703
7 SASI_Mm02_00299907 predicted 525
8 SASI_Mm02_00299908 predicted 1096
9 SASI_Mm02_00299909 predicted 1475
10 SASI_Mm02_00299910 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041434 predicted 753
2 SASI_Mm01_00041435 predicted 1143
3 SASI_Mm01_00041436 predicted 1667
4 SASI_Mm01_00041437 predicted 1553
5 SASI_Mm01_00041438 predicted 598
6 SASI_Mm02_00338640 predicted 1807
7 SASI_Mm01_00041439 predicted 626
8 SASI_Mm01_00041440 predicted 1194
9 SASI_Mm01_00041441 predicted 1568
10 SASI_Mm01_00041442 predicted 610
11 SASI_Mm01_00041443 predicted 1230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032558
VALIDATED
HIATL1 MISSION shRNA Bacterial Glycerol Stock
hippocampus abundant transcript-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-1884s1c1
Sequence:CCGGGCTGCTTCTAAGAAAGTTATTCTCGAGAATAACTTTCTTAGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-303s1c1
Sequence:CCGGGTCGTTGAAGAAAGTTGGAAACTCGAGTTTCCAACTTTCTTCAACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-301s1c1
Sequence:CCGGGCGTCGTTGAAGAAAGTTGGACTCGAGTCCAACTTTCTTCAACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-810s1c1
Sequence:CCGGCCCGAAATTGAATTCTAACAACTCGAGTTGTTAGAATTCAATTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-445s1c1
Sequence:CCGGGCAGCATTCATAGCTATGGTACTCGAGTACCATAGCTATGAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-1140s21c1
Sequence:CCGGGCAGCATTCATAGCTATGGTACTCGAGTACCATAGCTATGAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032558.2-2580s21c1
Sequence:CCGGGCTGCTTCTAAGAAAGTTATTCTCGAGAATAACTTTCTTAGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-996s21c1
Sequence:CCGGGCGTCGTTGAAGAAAGTTGGACTCGAGTCCAACTTTCTTCAACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-1505s21c1
Sequence:CCGGCCCGAAATTGAATTCTAACAACTCGAGTTGTTAGAATTCAATTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032558
VALIDATED
HIATL1 MISSION shRNA shRNA Plasmid DNA
hippocampus abundant transcript-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-1884s1c1
Sequence:CCGGGCTGCTTCTAAGAAAGTTATTCTCGAGAATAACTTTCTTAGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-303s1c1
Sequence:CCGGGTCGTTGAAGAAAGTTGGAAACTCGAGTTTCCAACTTTCTTCAACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-301s1c1
Sequence:CCGGGCGTCGTTGAAGAAAGTTGGACTCGAGTCCAACTTTCTTCAACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-810s1c1
Sequence:CCGGCCCGAAATTGAATTCTAACAACTCGAGTTGTTAGAATTCAATTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-445s1c1
Sequence:CCGGGCAGCATTCATAGCTATGGTACTCGAGTACCATAGCTATGAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-1140s21c1
Sequence:CCGGGCAGCATTCATAGCTATGGTACTCGAGTACCATAGCTATGAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032558.2-2580s21c1
Sequence:CCGGGCTGCTTCTAAGAAAGTTATTCTCGAGAATAACTTTCTTAGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-996s21c1
Sequence:CCGGGCGTCGTTGAAGAAAGTTGGACTCGAGTCCAACTTTCTTCAACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-1505s21c1
Sequence:CCGGCCCGAAATTGAATTCTAACAACTCGAGTTGTTAGAATTCAATTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032558
VALIDATED
HIATL1 MISSION shRNA Lentiviral Transduction Particles
hippocampus abundant transcript-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-1884s1c1
Sequence:CCGGGCTGCTTCTAAGAAAGTTATTCTCGAGAATAACTTTCTTAGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-303s1c1
Sequence:CCGGGTCGTTGAAGAAAGTTGGAAACTCGAGTTTCCAACTTTCTTCAACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-301s1c1
Sequence:CCGGGCGTCGTTGAAGAAAGTTGGACTCGAGTCCAACTTTCTTCAACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-810s1c1
Sequence:CCGGCCCGAAATTGAATTCTAACAACTCGAGTTGTTAGAATTCAATTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032558.1-445s1c1
Sequence:CCGGGCAGCATTCATAGCTATGGTACTCGAGTACCATAGCTATGAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-1140s21c1
Sequence:CCGGGCAGCATTCATAGCTATGGTACTCGAGTACCATAGCTATGAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032558.2-2580s21c1
Sequence:CCGGGCTGCTTCTAAGAAAGTTATTCTCGAGAATAACTTTCTTAGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-996s21c1
Sequence:CCGGGCGTCGTTGAAGAAAGTTGGACTCGAGTCCAACTTTCTTCAACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032558.2-1505s21c1
Sequence:CCGGCCCGAAATTGAATTCTAACAACTCGAGTTGTTAGAATTCAATTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133680
VALIDATED
HIATL1 MISSION shRNA Bacterial Glycerol Stock
hippocampus abundant transcript-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133680.2-2991s1c1
Sequence:CCGGGCTGCATAGTAAATGGACTATCTCGAGATAGTCCATTTACTATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-985s1c1
Sequence:CCGGCCGGAATCTCTATCGGAGAAACTCGAGTTTCTCCGATAGAGATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-693s1c1
Sequence:CCGGCTGCTTCCCTATCCCACTAATCTCGAGATTAGTGGGATAGGGAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-1061s1c1
Sequence:CCGGCGTCATTAAAGAAAGTTGGAACTCGAGTTCCAACTTTCTTTAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-1514s1c1
Sequence:CCGGCAGCATTATATGGCTTCATATCTCGAGATATGAAGCCATATAATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-1881s21c1
Sequence:CCGGGAGCTATAACCCAGTAGTAATCTCGAGATTACTACTGGGTTATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-1023s21c1
Sequence:CCGGCCGGAATCTCTATCGGAGAAACTCGAGTTTCTCCGATAGAGATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-731s21c1
Sequence:CCGGCTGCTTCCCTATCCCACTAATCTCGAGATTAGTGGGATAGGGAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-2316s21c1
Sequence:CCGGCATTCCCTCTTAGTCTATAAACTCGAGTTTATAGACTAAGAGGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133680
VALIDATED
HIATL1 MISSION shRNA shRNA Plasmid DNA
hippocampus abundant transcript-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133680.2-2991s1c1
Sequence:CCGGGCTGCATAGTAAATGGACTATCTCGAGATAGTCCATTTACTATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-985s1c1
Sequence:CCGGCCGGAATCTCTATCGGAGAAACTCGAGTTTCTCCGATAGAGATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-693s1c1
Sequence:CCGGCTGCTTCCCTATCCCACTAATCTCGAGATTAGTGGGATAGGGAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-1061s1c1
Sequence:CCGGCGTCATTAAAGAAAGTTGGAACTCGAGTTCCAACTTTCTTTAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-1514s1c1
Sequence:CCGGCAGCATTATATGGCTTCATATCTCGAGATATGAAGCCATATAATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-1881s21c1
Sequence:CCGGGAGCTATAACCCAGTAGTAATCTCGAGATTACTACTGGGTTATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-1023s21c1
Sequence:CCGGCCGGAATCTCTATCGGAGAAACTCGAGTTTCTCCGATAGAGATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-731s21c1
Sequence:CCGGCTGCTTCCCTATCCCACTAATCTCGAGATTAGTGGGATAGGGAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-2316s21c1
Sequence:CCGGCATTCCCTCTTAGTCTATAAACTCGAGTTTATAGACTAAGAGGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133680
VALIDATED
HIATL1 MISSION shRNA Lentiviral Transduction Particles
hippocampus abundant transcript-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133680.2-2991s1c1
Sequence:CCGGGCTGCATAGTAAATGGACTATCTCGAGATAGTCCATTTACTATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-985s1c1
Sequence:CCGGCCGGAATCTCTATCGGAGAAACTCGAGTTTCTCCGATAGAGATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-693s1c1
Sequence:CCGGCTGCTTCCCTATCCCACTAATCTCGAGATTAGTGGGATAGGGAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-1061s1c1
Sequence:CCGGCGTCATTAAAGAAAGTTGGAACTCGAGTTCCAACTTTCTTTAATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133680.2-1514s1c1
Sequence:CCGGCAGCATTATATGGCTTCATATCTCGAGATATGAAGCCATATAATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-1881s21c1
Sequence:CCGGGAGCTATAACCCAGTAGTAATCTCGAGATTACTACTGGGTTATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-1023s21c1
Sequence:CCGGCCGGAATCTCTATCGGAGAAACTCGAGTTTCTCCGATAGAGATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-731s21c1
Sequence:CCGGCTGCTTCCCTATCCCACTAATCTCGAGATTAGTGGGATAGGGAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133680.3-2316s21c1
Sequence:CCGGCATTCCCTCTTAGTCTATAAACTCGAGTTTATAGACTAAGAGGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)