EMAIL THIS PAGE TO A FRIEND

HIATL2

hippocampus abundant transcript-like 2

27 Gene Product Result for
Species: Human HIATL2(84278)
UniProtKB ID: Q5VZR4, Q9BSG7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032318 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148221 MISSION® esiRNA esiRNA human HIATL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002894 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377252 predicted 465
2 SASI_Hs02_00377253 predicted 357
3 SASI_Hs02_00377254 predicted 350
4 SASI_Hs02_00377255 predicted 349
5 SASI_Hs02_00377256 predicted 553
6 SASI_Hs02_00377257 predicted 321
7 SASI_Hs02_00377258 predicted 343
8 SASI_Hs02_00377259 predicted 500
9 SASI_Hs02_00377260 predicted 451
10 SASI_Hs02_00377261 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032318
VALIDATED
HIATL2 MISSION shRNA Bacterial Glycerol Stock
hippocampus abundant transcript-like 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-582s1c1
Sequence:CCGGCAATCCCACTGATGAGGATCACTCGAGTGATCCTCATCAGTGGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-559s1c1
Sequence:CCGGCACTGTATTCTTTACCTGCTTCTCGAGAAGCAGGTAAAGAATACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032318.1-440s1c1
Sequence:CCGGCAACACACATTCCTCATGAATCTCGAGATTCATGAGGAATGTGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-553s1c1
Sequence:CCGGCCTCGGCACTGTATTCTTTACCTCGAGGTAAAGAATACAGTGCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032318.1-558s1c1
Sequence:CCGGGCACTGTATTCTTTACCTGCTCTCGAGAGCAGGTAAAGAATACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-452s1c1
Sequence:CCGGCTCATGAATGGTCTCATTCAACTCGAGTTGAATGAGACCATTCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032318
VALIDATED
HIATL2 MISSION shRNA shRNA Plasmid DNA
hippocampus abundant transcript-like 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-582s1c1
Sequence:CCGGCAATCCCACTGATGAGGATCACTCGAGTGATCCTCATCAGTGGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-559s1c1
Sequence:CCGGCACTGTATTCTTTACCTGCTTCTCGAGAAGCAGGTAAAGAATACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032318.1-440s1c1
Sequence:CCGGCAACACACATTCCTCATGAATCTCGAGATTCATGAGGAATGTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-553s1c1
Sequence:CCGGCCTCGGCACTGTATTCTTTACCTCGAGGTAAAGAATACAGTGCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032318.1-558s1c1
Sequence:CCGGGCACTGTATTCTTTACCTGCTCTCGAGAGCAGGTAAAGAATACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-452s1c1
Sequence:CCGGCTCATGAATGGTCTCATTCAACTCGAGTTGAATGAGACCATTCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032318
VALIDATED
HIATL2 MISSION shRNA Lentiviral Transduction Particles
hippocampus abundant transcript-like 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-582s1c1
Sequence:CCGGCAATCCCACTGATGAGGATCACTCGAGTGATCCTCATCAGTGGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-559s1c1
Sequence:CCGGCACTGTATTCTTTACCTGCTTCTCGAGAAGCAGGTAAAGAATACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032318.1-440s1c1
Sequence:CCGGCAACACACATTCCTCATGAATCTCGAGATTCATGAGGAATGTGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-553s1c1
Sequence:CCGGCCTCGGCACTGTATTCTTTACCTCGAGGTAAAGAATACAGTGCCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032318.1-558s1c1
Sequence:CCGGGCACTGTATTCTTTACCTGCTCTCGAGAGCAGGTAAAGAATACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032318.1-452s1c1
Sequence:CCGGCTCATGAATGGTCTCATTCAACTCGAGTTGAATGAGACCATTCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)