EMAIL THIS PAGE TO A FRIEND

HIBCH

3-hydroxyisobutyryl-CoA hydrolase

79 Gene Product Result for
Synonyms: HIBYLCOAH
Gene ID:
Human(26275) Summary: This gene encodes the enzyme responsible for hydrolysis of both HIBYL-CoA and beta-hydroxypropionyl-CoA. Mutations in this gene have been associated with 3-hyroxyisobutyryl-CoA hydrolase deficiency. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(227095) 3-hydroxyisobutyryl-Coenzyme A hydrolase
Rat(301384) 3-hydroxyisobutyryl-CoA hydrolase
Zebrafish(798364) 3-hydroxyisobutyryl-Coenzyme A hydrolase
chicken(423979) 3-hydroxyisobutyryl-CoA hydrolase
dog(607040) 3-hydroxyisobutyryl-CoA hydrolase
domestic cat(101081824) 3-hydroxyisobutyryl-CoA hydrolase
Horse(100069399) 3-hydroxyisobutyryl-CoA hydrolase
cow(535883) 3-hydroxyisobutyryl-CoA hydrolase
domestic guinea pig(100725796) 3-hydroxyisobutyryl-CoA hydrolase
naked mole-rat(101725904) 3-hydroxyisobutyryl-CoA hydrolase
sheep(101111161) 3-hydroxyisobutyryl-CoA hydrolase
Domestic Rabbit(100342287) 3-hydroxyisobutyryl-CoA hydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014362 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014362 Rosetta Predictions human pricing
NM_198047 Rosetta Predictions human pricing
NM_001013112 Rosetta Predictions rat pricing
NM_146108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064760 predicted 650
2 SASI_Hs01_00064761 predicted 577
3 SASI_Hs01_00064762 predicted 482
4 SASI_Hs01_00064763 predicted 513
5 SASI_Hs01_00064764 predicted 475
6 SASI_Hs01_00064765 predicted 717
7 SASI_Hs01_00064766 predicted 767
8 SASI_Hs01_00064767 predicted 600
9 SASI_Hs01_00064768 predicted 445
10 SASI_Hs01_00064769 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145189 predicted 649
2 SASI_Hs01_00145190 predicted 579
3 SASI_Hs01_00145191 predicted 480
4 SASI_Hs01_00145192 predicted 522
5 SASI_Hs01_00145193 predicted 476
6 SASI_Hs01_00145194 predicted 717
7 SASI_Hs01_00145195 predicted 772
8 SASI_Hs01_00145196 predicted 604
9 SASI_Hs01_00145197 predicted 445
10 SASI_Hs01_00145198 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111680 predicted 833
2 SASI_Rn01_00111681 predicted 333
3 SASI_Rn01_00111682 predicted 855
4 SASI_Rn01_00111683 predicted 1090
5 SASI_Rn01_00111684 predicted 260
6 SASI_Rn01_00111685 predicted 971
7 SASI_Rn02_00200802 predicted 327
8 SASI_Rn01_00111686 predicted 496
9 SASI_Rn01_00111687 predicted 978
10 SASI_Rn01_00111688 predicted 921
11 SASI_Rn01_00111689 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341755 predicted 293
2 SASI_Mm01_00142819 predicted 1158
3 SASI_Mm01_00142820 predicted 1092
4 SASI_Mm01_00142821 predicted 690
5 SASI_Mm01_00142823 predicted 1080
6 SASI_Mm01_00142824 predicted 212
7 SASI_Mm01_00142826 predicted 252
8 SASI_Mm02_00341756 predicted 814
9 SASI_Mm01_00142827 predicted 1060
10 SASI_Mm01_00142828 predicted 560
11 SASI_Mm01_00142822 predicted 1202
12 SASI_Mm01_00142825 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146108
HIBCH MISSION shRNA Bacterial Glycerol Stock
3-hydroxyisobutyryl-CoA hydrolase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-249s21c1
Sequence:CCGGATATGATCCGGCAGATCTATCCTCGAGGATAGATCTGCCGGATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-1038s21c1
Sequence:CCGGTGATCATGGAATATCGGATAACTCGAGTTATCCGATATTCCATGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-566s1c1
Sequence:CCGGGAAACGGGAATAGGACTATTTCTCGAGAAATAGTCCTATTCCCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-232s1c1
Sequence:CCGGCAACGCACTGAGTCTGAATATCTCGAGATATTCAGACTCAGTGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-782s1c1
Sequence:CCGGGCAGGTGTCTTAGAAAGCTATCTCGAGATAGCTTTCTAAGACACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-589s21c1
Sequence:CCGGTGATGTGGGTGGAGGTTATTTCTCGAGAAATAACCTCCACCCACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146108.1-1513s21c1
Sequence:CCGGCACCTCAAGGGTCTAAGTTTCCTCGAGGAAACTTAGACCCTTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-1039s1c1
Sequence:CCGGGATCATGGAATATCGGATAACCTCGAGGTTATCCGATATTCCATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-566s21c1
Sequence:CCGGGAAACGGGAATAGGACTATTTCTCGAGAAATAGTCCTATTCCCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146108
HIBCH MISSION shRNA shRNA Plasmid DNA
3-hydroxyisobutyryl-CoA hydrolase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-249s21c1
Sequence:CCGGATATGATCCGGCAGATCTATCCTCGAGGATAGATCTGCCGGATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-1038s21c1
Sequence:CCGGTGATCATGGAATATCGGATAACTCGAGTTATCCGATATTCCATGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-566s1c1
Sequence:CCGGGAAACGGGAATAGGACTATTTCTCGAGAAATAGTCCTATTCCCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-232s1c1
Sequence:CCGGCAACGCACTGAGTCTGAATATCTCGAGATATTCAGACTCAGTGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-782s1c1
Sequence:CCGGGCAGGTGTCTTAGAAAGCTATCTCGAGATAGCTTTCTAAGACACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-589s21c1
Sequence:CCGGTGATGTGGGTGGAGGTTATTTCTCGAGAAATAACCTCCACCCACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146108.1-1513s21c1
Sequence:CCGGCACCTCAAGGGTCTAAGTTTCCTCGAGGAAACTTAGACCCTTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-1039s1c1
Sequence:CCGGGATCATGGAATATCGGATAACCTCGAGGTTATCCGATATTCCATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-566s21c1
Sequence:CCGGGAAACGGGAATAGGACTATTTCTCGAGAAATAGTCCTATTCCCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146108
HIBCH MISSION shRNA Lentiviral Transduction Particles
3-hydroxyisobutyryl-CoA hydrolase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-249s21c1
Sequence:CCGGATATGATCCGGCAGATCTATCCTCGAGGATAGATCTGCCGGATCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-1038s21c1
Sequence:CCGGTGATCATGGAATATCGGATAACTCGAGTTATCCGATATTCCATGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-566s1c1
Sequence:CCGGGAAACGGGAATAGGACTATTTCTCGAGAAATAGTCCTATTCCCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-232s1c1
Sequence:CCGGCAACGCACTGAGTCTGAATATCTCGAGATATTCAGACTCAGTGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-782s1c1
Sequence:CCGGGCAGGTGTCTTAGAAAGCTATCTCGAGATAGCTTTCTAAGACACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-589s21c1
Sequence:CCGGTGATGTGGGTGGAGGTTATTTCTCGAGAAATAACCTCCACCCACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146108.1-1513s21c1
Sequence:CCGGCACCTCAAGGGTCTAAGTTTCCTCGAGGAAACTTAGACCCTTGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146108.1-1039s1c1
Sequence:CCGGGATCATGGAATATCGGATAACCTCGAGGTTATCCGATATTCCATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146108.1-566s21c1
Sequence:CCGGGAAACGGGAATAGGACTATTTCTCGAGAAATAGTCCTATTCCCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014362
VALIDATED
HIBCH MISSION shRNA Bacterial Glycerol Stock
3-hydroxyisobutyryl-CoA hydrolase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014362.2-269s21c1
Sequence:CCGGTAATATGATTCGGCAGATTTACTCGAGTAAATCTGCCGAATCATATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-1157s21c1
Sequence:CCGGATGGAAACCAGCTGATCTAAACTCGAGTTTAGATCAGCTGGTTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-1343s21c1
Sequence:GTACCGGCTAAGAATGGTTTCCGCATTTCTCGAGAAATGCGGAAACCATTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-611s21c1
Sequence:CCGGTGATGTGGGTGGAGGTTATTTCTCGAGAAATAACCTCCACCCACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014362.2-1481s1c1
Sequence:CCGGGCTGCTTTGAAATGAGTAGTTCTCGAGAACTACTCATTTCAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_014362.2-152s1c1
Sequence:CCGGGCACCATTTGAGAATGTCCAACTCGAGTTGGACATTCTCAAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014362.2-291s1c1
Sequence:CCGGCCACAGCTAAAGAAGTGGGAACTCGAGTTCCCACTTCTTTAGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014362.2-267s1c1
Sequence:CCGGCTTAATATGATTCGGCAGATTCTCGAGAATCTGCCGAATCATATTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014362.2-959s1c1
Sequence:CCGGCCTAGAGCAATTGAAGGTAATCTCGAGATTACCTTCAATTGCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-320s21c1
Sequence:CCGGTGAAACTTTCCTGATCATTATCTCGAGATAATGATCAGGAAAGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014362
VALIDATED
HIBCH MISSION shRNA shRNA Plasmid DNA
3-hydroxyisobutyryl-CoA hydrolase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014362.2-269s21c1
Sequence:CCGGTAATATGATTCGGCAGATTTACTCGAGTAAATCTGCCGAATCATATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-1157s21c1
Sequence:CCGGATGGAAACCAGCTGATCTAAACTCGAGTTTAGATCAGCTGGTTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-1343s21c1
Sequence:GTACCGGCTAAGAATGGTTTCCGCATTTCTCGAGAAATGCGGAAACCATTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-611s21c1
Sequence:CCGGTGATGTGGGTGGAGGTTATTTCTCGAGAAATAACCTCCACCCACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014362.2-1481s1c1
Sequence:CCGGGCTGCTTTGAAATGAGTAGTTCTCGAGAACTACTCATTTCAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_014362.2-152s1c1
Sequence:CCGGGCACCATTTGAGAATGTCCAACTCGAGTTGGACATTCTCAAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014362.2-291s1c1
Sequence:CCGGCCACAGCTAAAGAAGTGGGAACTCGAGTTCCCACTTCTTTAGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014362.2-267s1c1
Sequence:CCGGCTTAATATGATTCGGCAGATTCTCGAGAATCTGCCGAATCATATTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014362.2-959s1c1
Sequence:CCGGCCTAGAGCAATTGAAGGTAATCTCGAGATTACCTTCAATTGCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-320s21c1
Sequence:CCGGTGAAACTTTCCTGATCATTATCTCGAGATAATGATCAGGAAAGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014362
VALIDATED
HIBCH MISSION shRNA Lentiviral Transduction Particles
3-hydroxyisobutyryl-CoA hydrolase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014362.2-269s21c1
Sequence:CCGGTAATATGATTCGGCAGATTTACTCGAGTAAATCTGCCGAATCATATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-1157s21c1
Sequence:CCGGATGGAAACCAGCTGATCTAAACTCGAGTTTAGATCAGCTGGTTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-1343s21c1
Sequence:GTACCGGCTAAGAATGGTTTCCGCATTTCTCGAGAAATGCGGAAACCATTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-611s21c1
Sequence:CCGGTGATGTGGGTGGAGGTTATTTCTCGAGAAATAACCTCCACCCACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014362.2-1481s1c1
Sequence:CCGGGCTGCTTTGAAATGAGTAGTTCTCGAGAACTACTCATTTCAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_014362.2-152s1c1
Sequence:CCGGGCACCATTTGAGAATGTCCAACTCGAGTTGGACATTCTCAAATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014362.2-291s1c1
Sequence:CCGGCCACAGCTAAAGAAGTGGGAACTCGAGTTCCCACTTCTTTAGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014362.2-267s1c1
Sequence:CCGGCTTAATATGATTCGGCAGATTCTCGAGAATCTGCCGAATCATATTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014362.2-959s1c1
Sequence:CCGGCCTAGAGCAATTGAAGGTAATCTCGAGATTACCTTCAATTGCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014362.2-320s21c1
Sequence:CCGGTGAAACTTTCCTGATCATTATCTCGAGATAATGATCAGGAAAGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)