EMAIL THIS PAGE TO A FRIEND

HIC1

hypermethylated in cancer 1

85 Gene Product Result for
Synonyms: ZBTB29 ZNF901 hic-1
UniProtKB ID: Q14526, D3DTI4
Gene ID:
Human(3090) Summary: This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Mouse(15248) hypermethylated in cancer 1
Rat(303310) hypermethylated in cancer 1
domestic guinea pig(100735553) hypermethylated in cancer 1
naked mole-rat(101704969) hypermethylated in cancer 1
Zebrafish(436585) hypermethylated in cancer 1
chicken(396164) hypermethylated in cancer 1
cow(786191) hypermethylated in cancer 1
domestic cat(101083555) hypermethylated in cancer 1
dog(491198) hypermethylated in cancer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H8414 Anti-HIC1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation (IP), western blot pricing
SAB1412231 ANTI-HIC1 antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412347 ANTI-HIC1 antibody produced in mouse clone 2C1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412348 ANTI-HIC1 antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412349 ANTI-HIC1 antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
H8539 Anti-HIC1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, immunoprecipitation (IP), western blot pricing
AV32623 Anti-HIC1 antibody produced in rabbit affinity isolated antibody human, guinea pig, rat, mouse
western blot pricing
SAB2103167 Anti-HIC1 antibody produced in rabbit affinity isolated antibody guinea pig, rat, bovine, horse, mouse, canine, human
western blot pricing
HPA043372 Anti-HIC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104634 Anti-HIC1, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, rat, mouse, guinea pig, canine, human
western blot pricing
WH0003090M1 Monoclonal Anti-HIC1 antibody produced in mouse clone 4E11, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB1403915 Monoclonal Anti-HIC1 antibody produced in mouse clone 2F9, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089251 MISSION® esiRNA esiRNA targeting mouse Hic1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098202 Rosetta Predictions human pricing
NM_006497 Rosetta Predictions human pricing
NM_001107021 Rosetta Predictions rat pricing
NM_001098203 Rosetta Predictions mouse pricing
NM_010430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318638 predicted 1601
2 SASI_Hs02_00318639 predicted 1517
3 SASI_Hs02_00318640 predicted 233
4 SASI_Hs02_00318641 predicted 840
5 SASI_Hs02_00318642 predicted 2156
6 SASI_Hs02_00318643 predicted 1582
7 SASI_Hs02_00318644 predicted 243
8 SASI_Hs02_00318645 predicted 1340
9 SASI_Hs02_00318646 predicted 1518
10 SASI_Hs02_00318647 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028256 predicted 1700
2 SASI_Hs02_00341698 predicted 1616
3 SASI_Hs01_00028259 predicted 338
4 SASI_Hs02_00341699 predicted 943
5 SASI_Hs02_00341700 predicted 2256
6 SASI_Hs02_00341701 predicted 1690
7 SASI_Hs01_00028261 predicted 341
8 SASI_Hs01_00028262 predicted 1448
9 SASI_Hs02_00341702 predicted 1628
10 SASI_Hs02_00341703 predicted 2282
11 SASI_Hs01_00028255 predicted 360
12 SASI_Hs01_00028257 predicted 399
13 SASI_Hs01_00028258 predicted 399
14 SASI_Hs01_00028260 predicted 383
15 SASI_Hs01_00028263 predicted 398
16 SASI_Hs01_00028264 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224706 predicted 1986
2 SASI_Rn02_00224707 predicted 2193
3 SASI_Rn02_00224708 predicted 1668
4 SASI_Rn02_00224709 predicted 1970
5 SASI_Rn02_00224710 predicted 1730
6 SASI_Rn02_00224711 predicted 1397
7 SASI_Rn02_00224712 predicted 1643
8 SASI_Rn02_00224713 predicted 1402
9 SASI_Rn02_00224714 predicted 616
10 SASI_Rn02_00224715 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301257 predicted 1605
2 SASI_Mm02_00301258 predicted 1805
3 SASI_Mm02_00301259 predicted 2618
4 SASI_Mm02_00301260 predicted 1934
5 SASI_Mm02_00301261 predicted 2023
6 SASI_Mm02_00301262 predicted 1232
7 SASI_Mm02_00301263 predicted 761
8 SASI_Mm02_00301264 predicted 2291
9 SASI_Mm02_00301265 predicted 1564
10 SASI_Mm02_00301266 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096040 predicted 2598
2 SASI_Mm01_00096041 predicted 2797
3 SASI_Mm01_00096042 predicted 3608
4 SASI_Mm01_00096043 predicted 2932
5 SASI_Mm01_00096044 predicted 3017
6 SASI_Mm01_00096045 predicted 2224
7 SASI_Mm01_00096046 predicted 3281
8 SASI_Mm01_00096047 predicted 2560
9 SASI_Mm01_00096049 predicted 2478
10 SASI_Mm02_00318581 predicted 2899
11 SASI_Mm01_00096048 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006497
VALIDATED
HIC1 MISSION shRNA Bacterial Glycerol Stock
hypermethylated in cancer 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006497.1-392s1c1
Sequence:CCGGGCTGTGCAAGAAACGCCTCAACTCGAGTTGAGGCGTTTCTTGCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-1982s1c1
Sequence:CCGGGCTGGCGCAGACCACGCACTTCTCGAGAAGTGCGTGGTCTGCGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-116s1c1
Sequence:CCGGCGTGGTGCAGAACGCCCTCTTCTCGAGAAGAGGGCGTTCTGCACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-1763s1c1
Sequence:CCGGCGCACAGCAACGCAACCTCATCTCGAGATGAGGTTGCGTTGCTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-941s1c1
Sequence:CCGGTCTCCTCTATCGCTGGATGAACTCGAGTTCATCCAGCGATAGAGGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-2175s21c1
Sequence:CCGGTCTACCCGCTGGCCAAGTTCACTCGAGTGAACTTGGCCAGCGGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-1633s21c1
Sequence:CCGGGTCGTGCGACAAGAGCTACAACTCGAGTTGTAGCTCTTGTCGCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-533s21c1
Sequence:CCGGCTGTGCAAGAAACGCCTCAAGCTCGAGCTTGAGGCGTTTCTTGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006497.3-2538s21c1
Sequence:CCGGTGATATCAGCTTTGACCAAAGCTCGAGCTTTGGTCAAAGCTGATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-234s21c1
Sequence:CCGGGCTTCTTGTGCGACGTGATCACTCGAGTGATCACGTCGCACAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-1711s21c1
Sequence:CCGGATGCACCATCTGCGGGAAGAACTCGAGTTCTTCCCGCAGATGGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006497.3-2804s21c1
Sequence:CCGGGGGACTGATAATGTGAAGTTCCTCGAGGAACTTCACATTATCAGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-335s21c1
Sequence:CCGGCATGACAACCTGCTCAACCTGCTCGAGCAGGTTGAGCAGGTTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006497
VALIDATED
HIC1 MISSION shRNA shRNA Plasmid DNA
hypermethylated in cancer 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006497.1-392s1c1
Sequence:CCGGGCTGTGCAAGAAACGCCTCAACTCGAGTTGAGGCGTTTCTTGCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-1982s1c1
Sequence:CCGGGCTGGCGCAGACCACGCACTTCTCGAGAAGTGCGTGGTCTGCGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-116s1c1
Sequence:CCGGCGTGGTGCAGAACGCCCTCTTCTCGAGAAGAGGGCGTTCTGCACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-1763s1c1
Sequence:CCGGCGCACAGCAACGCAACCTCATCTCGAGATGAGGTTGCGTTGCTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-941s1c1
Sequence:CCGGTCTCCTCTATCGCTGGATGAACTCGAGTTCATCCAGCGATAGAGGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-2175s21c1
Sequence:CCGGTCTACCCGCTGGCCAAGTTCACTCGAGTGAACTTGGCCAGCGGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-1633s21c1
Sequence:CCGGGTCGTGCGACAAGAGCTACAACTCGAGTTGTAGCTCTTGTCGCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-533s21c1
Sequence:CCGGCTGTGCAAGAAACGCCTCAAGCTCGAGCTTGAGGCGTTTCTTGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006497.3-2538s21c1
Sequence:CCGGTGATATCAGCTTTGACCAAAGCTCGAGCTTTGGTCAAAGCTGATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-234s21c1
Sequence:CCGGGCTTCTTGTGCGACGTGATCACTCGAGTGATCACGTCGCACAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-1711s21c1
Sequence:CCGGATGCACCATCTGCGGGAAGAACTCGAGTTCTTCCCGCAGATGGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006497.3-2804s21c1
Sequence:CCGGGGGACTGATAATGTGAAGTTCCTCGAGGAACTTCACATTATCAGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-335s21c1
Sequence:CCGGCATGACAACCTGCTCAACCTGCTCGAGCAGGTTGAGCAGGTTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006497
VALIDATED
HIC1 MISSION shRNA Lentiviral Transduction Particles
hypermethylated in cancer 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006497.1-392s1c1
Sequence:CCGGGCTGTGCAAGAAACGCCTCAACTCGAGTTGAGGCGTTTCTTGCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-1982s1c1
Sequence:CCGGGCTGGCGCAGACCACGCACTTCTCGAGAAGTGCGTGGTCTGCGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-116s1c1
Sequence:CCGGCGTGGTGCAGAACGCCCTCTTCTCGAGAAGAGGGCGTTCTGCACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-1763s1c1
Sequence:CCGGCGCACAGCAACGCAACCTCATCTCGAGATGAGGTTGCGTTGCTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006497.1-941s1c1
Sequence:CCGGTCTCCTCTATCGCTGGATGAACTCGAGTTCATCCAGCGATAGAGGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-2175s21c1
Sequence:CCGGTCTACCCGCTGGCCAAGTTCACTCGAGTGAACTTGGCCAGCGGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-1633s21c1
Sequence:CCGGGTCGTGCGACAAGAGCTACAACTCGAGTTGTAGCTCTTGTCGCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-533s21c1
Sequence:CCGGCTGTGCAAGAAACGCCTCAAGCTCGAGCTTGAGGCGTTTCTTGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006497.3-2538s21c1
Sequence:CCGGTGATATCAGCTTTGACCAAAGCTCGAGCTTTGGTCAAAGCTGATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-234s21c1
Sequence:CCGGGCTTCTTGTGCGACGTGATCACTCGAGTGATCACGTCGCACAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-1711s21c1
Sequence:CCGGATGCACCATCTGCGGGAAGAACTCGAGTTCTTCCCGCAGATGGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006497.3-2804s21c1
Sequence:CCGGGGGACTGATAATGTGAAGTTCCTCGAGGAACTTCACATTATCAGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006497.3-335s21c1
Sequence:CCGGCATGACAACCTGCTCAACCTGCTCGAGCAGGTTGAGCAGGTTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010430
HIC1 MISSION shRNA Bacterial Glycerol Stock
hypermethylated in cancer 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010430.1-3130s1c1
Sequence:CCGGCGGGACTGATAATGTGAAGTTCTCGAGAACTTCACATTATCAGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-1489s1c1
Sequence:CCGGCTGGGTAGTTATGGCGATGAACTCGAGTTCATCGCCATAACTACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-2556s1c1
Sequence:CCGGGCTGGCTAAATTCACTGCTGACTCGAGTCAGCAGTGAATTTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-2118s1c1
Sequence:CCGGCGGAACCATGACACGCCATATCTCGAGATATGGCGTGTCATGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-79s1c1
Sequence:CCGGTGGCGCGATATAACATATAAACTCGAGTTTATATGTTATATCGCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-1853s21c1
Sequence:CCGGACCCACTGCGCTGAGCTATATCTCGAGATATAGCTCAGCGCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010430.2-3877s21c1
Sequence:CCGGATAATGTGAAGTTCCTCATTTCTCGAGAAATGAGGAACTTCACATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-2597s21c1
Sequence:CCGGGAGGAAGAAGAGGCGTTATATCTCGAGATATAACGCCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-2386s21c1
Sequence:CCGGAGCAGACGGCGACGACTATAACTCGAGTTATAGTCGTCGCCGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-811s21c1
Sequence:CCGGCCCGAATTGGCGCGATATAACCTCGAGGTTATATCGCGCCAATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-3286s21c1
Sequence:CCGGCCTCTACCCGCTGGCTAAATTCTCGAGAATTTAGCCAGCGGGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010430.2-3613s21c1
Sequence:CCGGTGATATCAGCTTTGACCAAAGCTCGAGCTTTGGTCAAAGCTGATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-3025s21c1
Sequence:CCGGGCGCAACCTCATCAGCCATATCTCGAGATATGGCTGATGAGGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010430
HIC1 MISSION shRNA shRNA Plasmid DNA
hypermethylated in cancer 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010430.1-3130s1c1
Sequence:CCGGCGGGACTGATAATGTGAAGTTCTCGAGAACTTCACATTATCAGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-1489s1c1
Sequence:CCGGCTGGGTAGTTATGGCGATGAACTCGAGTTCATCGCCATAACTACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-2556s1c1
Sequence:CCGGGCTGGCTAAATTCACTGCTGACTCGAGTCAGCAGTGAATTTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-2118s1c1
Sequence:CCGGCGGAACCATGACACGCCATATCTCGAGATATGGCGTGTCATGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-79s1c1
Sequence:CCGGTGGCGCGATATAACATATAAACTCGAGTTTATATGTTATATCGCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-1853s21c1
Sequence:CCGGACCCACTGCGCTGAGCTATATCTCGAGATATAGCTCAGCGCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010430.2-3877s21c1
Sequence:CCGGATAATGTGAAGTTCCTCATTTCTCGAGAAATGAGGAACTTCACATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-2597s21c1
Sequence:CCGGGAGGAAGAAGAGGCGTTATATCTCGAGATATAACGCCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-2386s21c1
Sequence:CCGGAGCAGACGGCGACGACTATAACTCGAGTTATAGTCGTCGCCGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-811s21c1
Sequence:CCGGCCCGAATTGGCGCGATATAACCTCGAGGTTATATCGCGCCAATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-3286s21c1
Sequence:CCGGCCTCTACCCGCTGGCTAAATTCTCGAGAATTTAGCCAGCGGGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010430.2-3613s21c1
Sequence:CCGGTGATATCAGCTTTGACCAAAGCTCGAGCTTTGGTCAAAGCTGATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-3025s21c1
Sequence:CCGGGCGCAACCTCATCAGCCATATCTCGAGATATGGCTGATGAGGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010430
HIC1 MISSION shRNA Lentiviral Transduction Particles
hypermethylated in cancer 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010430.1-3130s1c1
Sequence:CCGGCGGGACTGATAATGTGAAGTTCTCGAGAACTTCACATTATCAGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-1489s1c1
Sequence:CCGGCTGGGTAGTTATGGCGATGAACTCGAGTTCATCGCCATAACTACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-2556s1c1
Sequence:CCGGGCTGGCTAAATTCACTGCTGACTCGAGTCAGCAGTGAATTTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-2118s1c1
Sequence:CCGGCGGAACCATGACACGCCATATCTCGAGATATGGCGTGTCATGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010430.1-79s1c1
Sequence:CCGGTGGCGCGATATAACATATAAACTCGAGTTTATATGTTATATCGCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-1853s21c1
Sequence:CCGGACCCACTGCGCTGAGCTATATCTCGAGATATAGCTCAGCGCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010430.2-3877s21c1
Sequence:CCGGATAATGTGAAGTTCCTCATTTCTCGAGAAATGAGGAACTTCACATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-2597s21c1
Sequence:CCGGGAGGAAGAAGAGGCGTTATATCTCGAGATATAACGCCTCTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-2386s21c1
Sequence:CCGGAGCAGACGGCGACGACTATAACTCGAGTTATAGTCGTCGCCGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-811s21c1
Sequence:CCGGCCCGAATTGGCGCGATATAACCTCGAGGTTATATCGCGCCAATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-3286s21c1
Sequence:CCGGCCTCTACCCGCTGGCTAAATTCTCGAGAATTTAGCCAGCGGGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010430.2-3613s21c1
Sequence:CCGGTGATATCAGCTTTGACCAAAGCTCGAGCTTTGGTCAAAGCTGATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010430.2-3025s21c1
Sequence:CCGGGCGCAACCTCATCAGCCATATCTCGAGATATGGCTGATGAGGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)