EMAIL THIS PAGE TO A FRIEND

HID1

HID1 domain containing

69 Gene Product Result for
Synonyms: C17orf28 DMC1 HID-1
UniProtKB ID: Q8IV36, Q8N5L6, Q8TE83, Q9NT34
Gene ID:
Mouse(217310) HID1 domain containing
Rat(287822) HID1 domain containing
dog(483305) HID1 domain containing
cow(540436) HID1 domain containing
domestic cat(101092717) HID1 domain containing
sheep(101123478) HID1 domain containing
domestic guinea pig(100720857) HID1 domain containing
naked mole-rat(101703541) HID1 domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030630 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030630 Rosetta Predictions human pricing
XM_001081678 Rosetta Predictions rat pricing
XM_213523 Rosetta Predictions rat pricing
NM_175454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160818 predicted 2579
2 SASI_Hs01_00160819 predicted 727
3 SASI_Hs01_00160820 predicted 2578
4 SASI_Hs02_00358193 predicted 1298
5 SASI_Hs02_00358194 predicted 2265
6 SASI_Hs01_00160822 predicted 1461
7 SASI_Hs01_00160823 predicted 914
8 SASI_Hs01_00160824 predicted 2013
9 SASI_Hs01_00160825 predicted 2583
10 SASI_Hs01_00160826 predicted 1170
11 SASI_Hs01_00160821 predicted 2191
12 SASI_Hs01_00160827 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372952 predicted 1663
2 SASI_Rn02_00372953 predicted 1433
3 SASI_Rn02_00372954 predicted 2709
4 SASI_Rn02_00372955 predicted 2725
5 SASI_Rn02_00372956 predicted 2161
6 SASI_Rn02_00372957 predicted 1536
7 SASI_Rn02_00372958 predicted 1052
8 SASI_Rn02_00372959 predicted 1934
9 SASI_Rn02_00372960 predicted 961
10 SASI_Rn02_00372961 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374696 predicted 1660
2 SASI_Rn02_00374697 predicted 1432
3 SASI_Rn02_00374698 predicted 2710
4 SASI_Rn02_00374699 predicted 2720
5 SASI_Rn02_00374700 predicted 2403
6 SASI_Rn02_00374701 predicted 2161
7 SASI_Rn02_00374702 predicted 1533
8 SASI_Rn02_00374703 predicted 1053
9 SASI_Rn02_00374704 predicted 1933
10 SASI_Rn02_00374705 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101008 predicted 2151
2 SASI_Mm01_00101009 predicted 2389
3 SASI_Mm01_00101010 predicted 1257
4 SASI_Mm01_00101011 predicted 1757
5 SASI_Mm01_00101012 predicted 293
6 SASI_Mm01_00101013 predicted 2395
7 SASI_Mm01_00101014 predicted 1656
8 SASI_Mm01_00101015 predicted 1185
9 SASI_Mm01_00101016 predicted 2108
10 SASI_Mm01_00101017 predicted 2268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030630
VALIDATED
HID1 MISSION shRNA Bacterial Glycerol Stock
HID1 domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1670s1c1
Sequence:CCGGCTTCAACAACATCATCCAGTACTCGAGTACTGGATGATGTTGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-734s21c1
Sequence:CCGGGCCTAACTACATCCACGATATCTCGAGATATCGTGGATGTAGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-1196s1c1
Sequence:CCGGGCTCTGCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-1025s1c1
Sequence:CCGGCCCTGAGAACCTGTTTGTGAACTCGAGTTCACAAACAGGTTCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-2499s1c1
Sequence:CCGGCCACCATTCTGAGCTTTAAATCTCGAGATTTAAAGCTCAGAATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1379s1c1
Sequence:CCGGGCTGAACAAACCCTACTCAATCTCGAGATTGAGTAGGGTTTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-2399s1c1
Sequence:CCGGCGACGTGAAGCTGTTTGAGATCTCGAGATCTCAAACAGCTTCACGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-1280s21c1
Sequence:CCGGGCTCTGCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1079s1c1
Sequence:CCGGCCAGTTCATCCTCAAGGGTATCTCGAGATACCCTTGAGGATGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-1109s21c1
Sequence:CCGGCCCTGAGAACCTGTTTGTGAACTCGAGTTCACAAACAGGTTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-2583s21c1
Sequence:CCGGCCACCATTCTGAGCTTTAAATCTCGAGATTTAAAGCTCAGAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030630
VALIDATED
HID1 MISSION shRNA shRNA Plasmid DNA
HID1 domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1670s1c1
Sequence:CCGGCTTCAACAACATCATCCAGTACTCGAGTACTGGATGATGTTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-734s21c1
Sequence:CCGGGCCTAACTACATCCACGATATCTCGAGATATCGTGGATGTAGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-1196s1c1
Sequence:CCGGGCTCTGCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-1025s1c1
Sequence:CCGGCCCTGAGAACCTGTTTGTGAACTCGAGTTCACAAACAGGTTCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-2499s1c1
Sequence:CCGGCCACCATTCTGAGCTTTAAATCTCGAGATTTAAAGCTCAGAATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1379s1c1
Sequence:CCGGGCTGAACAAACCCTACTCAATCTCGAGATTGAGTAGGGTTTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-2399s1c1
Sequence:CCGGCGACGTGAAGCTGTTTGAGATCTCGAGATCTCAAACAGCTTCACGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-1280s21c1
Sequence:CCGGGCTCTGCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1079s1c1
Sequence:CCGGCCAGTTCATCCTCAAGGGTATCTCGAGATACCCTTGAGGATGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-1109s21c1
Sequence:CCGGCCCTGAGAACCTGTTTGTGAACTCGAGTTCACAAACAGGTTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-2583s21c1
Sequence:CCGGCCACCATTCTGAGCTTTAAATCTCGAGATTTAAAGCTCAGAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030630
VALIDATED
HID1 MISSION shRNA Lentiviral Transduction Particles
HID1 domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1670s1c1
Sequence:CCGGCTTCAACAACATCATCCAGTACTCGAGTACTGGATGATGTTGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-734s21c1
Sequence:CCGGGCCTAACTACATCCACGATATCTCGAGATATCGTGGATGTAGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-1196s1c1
Sequence:CCGGGCTCTGCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-1025s1c1
Sequence:CCGGCCCTGAGAACCTGTTTGTGAACTCGAGTTCACAAACAGGTTCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030630.1-2499s1c1
Sequence:CCGGCCACCATTCTGAGCTTTAAATCTCGAGATTTAAAGCTCAGAATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1379s1c1
Sequence:CCGGGCTGAACAAACCCTACTCAATCTCGAGATTGAGTAGGGTTTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-2399s1c1
Sequence:CCGGCGACGTGAAGCTGTTTGAGATCTCGAGATCTCAAACAGCTTCACGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-1280s21c1
Sequence:CCGGGCTCTGCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030630.1-1079s1c1
Sequence:CCGGCCAGTTCATCCTCAAGGGTATCTCGAGATACCCTTGAGGATGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-1109s21c1
Sequence:CCGGCCCTGAGAACCTGTTTGTGAACTCGAGTTCACAAACAGGTTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030630.2-2583s21c1
Sequence:CCGGCCACCATTCTGAGCTTTAAATCTCGAGATTTAAAGCTCAGAATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175454
VALIDATED
HID1 MISSION shRNA Bacterial Glycerol Stock
HID1 domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-695s1c1
Sequence:CCGGGCCCAACTACATCCATGACATCTCGAGATGTCATGGATGTAGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175454.1-1485s1c1
Sequence:CCGGGCAGATTTGCTCATTGTGGTACTCGAGTACCACAATGAGCAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175454.1-2628s1c1
Sequence:CCGGGCTGGAGACAACAGGGATTTACTCGAGTAAATCCCTGTTGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-1730s1c1
Sequence:CCGGCCAGTACCAGTTTGATGGCAACTCGAGTTGCCATCAAACTGGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-1731s1c1
Sequence:CCGGCAGTACCAGTTTGATGGCAATCTCGAGATTGCCATCAAACTGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175454
VALIDATED
HID1 MISSION shRNA shRNA Plasmid DNA
HID1 domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-695s1c1
Sequence:CCGGGCCCAACTACATCCATGACATCTCGAGATGTCATGGATGTAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175454.1-1485s1c1
Sequence:CCGGGCAGATTTGCTCATTGTGGTACTCGAGTACCACAATGAGCAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175454.1-2628s1c1
Sequence:CCGGGCTGGAGACAACAGGGATTTACTCGAGTAAATCCCTGTTGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-1730s1c1
Sequence:CCGGCCAGTACCAGTTTGATGGCAACTCGAGTTGCCATCAAACTGGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-1731s1c1
Sequence:CCGGCAGTACCAGTTTGATGGCAATCTCGAGATTGCCATCAAACTGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175454
VALIDATED
HID1 MISSION shRNA Lentiviral Transduction Particles
HID1 domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-695s1c1
Sequence:CCGGGCCCAACTACATCCATGACATCTCGAGATGTCATGGATGTAGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175454.1-1485s1c1
Sequence:CCGGGCAGATTTGCTCATTGTGGTACTCGAGTACCACAATGAGCAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175454.1-2628s1c1
Sequence:CCGGGCTGGAGACAACAGGGATTTACTCGAGTAAATCCCTGTTGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-1730s1c1
Sequence:CCGGCCAGTACCAGTTTGATGGCAACTCGAGTTGCCATCAAACTGGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175454.1-1731s1c1
Sequence:CCGGCAGTACCAGTTTGATGGCAATCTCGAGATTGCCATCAAACTGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)