EMAIL THIS PAGE TO A FRIEND

HIF1A

hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)

160 Gene Product Result for
Synonyms: HIF-1A HIF-1alpha HIF1 HIF1-ALPHA MOP1 PASD8 bHLHe78
UniProtKB ID: Q16665, C0LZJ3, Q53XP6, Q96PT9, Q9UPB1
Gene ID:
Human(3091) Summary: This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011]
Mouse(15251) hypoxia inducible factor 1, alpha subunit
Rat(29560) hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
chicken(374177) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
dog(480348) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
cow(281814) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
domestic cat(101083686) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
domestic guinea pig(100713113) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
naked mole-rat(101715845) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
sheep(443519) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Domestic Rabbit(100009579) hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108674 Anti-HIF1A affinity isolated antibody bovine, rat, human, horse, dog, rabbit, goat, guinea pig
immunohistochemistry, western blot pricing
SAB2108753 Anti-HIF1A affinity isolated antibody bovine, human, horse, dog, goat, mouse, guinea pig, rat, rabbit
western blot pricing
SAB1405933 Anti-HIF1A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001275 Anti-HIF1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2101039 Anti-HIF1A antibody produced in rabbit affinity isolated antibody horse, human, rat, pig, bovine, rabbit, rabbit, mouse, guinea pig
western blot pricing
SAB2104366 Anti-HIF1A antibody produced in rabbit affinity isolated antibody horse, mouse, rabbit, canine, rabbit, rat, human, pig, guinea pig, bovine
western blot pricing
SAB2702132 Anti-HIF1A antibody produced in rabbit mouse, rat, human, bovine
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA000907 Anti-HIF1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1306599 ANTI-HIF1ALPHA (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306172 ANTI-HIF1ALPHA(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
PLA0304 Goat anti-HIF1-alpha Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), proximity ligation assay pricing
SAB5200017 Monoclonal Anti-HIF-1 α antibody produced in mouse clone ESEE122, 1 mg/mL, purified immunoglobulin human, rat, bovine, mouse
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
H6536 Monoclonal Anti-HIF-1α antibody produced in mouse ~1 mg/mL, clone H1α67, purified immunoglobulin, buffered aqueous solution human, sheep, mouse, ferret, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
H6411 Monoclonal Anti-HIF-1α antibody produced in mouse ~1 mg/mL, clone OZ12, purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP) pricing
SAB1403916 Monoclonal Anti-HIF1A, (C-terminal) antibody produced in mouse clone 1D4, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
PLA0081 Rabbit anti-HIF1-alpha Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001530 Rosetta Predictions human pricing
NM_181054 Rosetta Predictions human pricing
NM_024359 Rosetta Predictions rat pricing
NM_010431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332063 predicted 1801
2 SASI_Hs01_00122699 predicted 642
3 SASI_Hs01_00122700 predicted 627
4 SASI_Hs01_00122701 predicted 1549
5 SASI_Hs01_00122703 predicted 1288
6 SASI_Hs01_00122704 predicted 1539
7 SASI_Hs01_00122705 predicted 425
8 SASI_Hs01_00122707 predicted 873
9 SASI_Hs02_00332064 predicted 1399
10 SASI_Hs02_00332065 predicted 944
11 SASI_Hs01_00122698 predicted 2020
12 SASI_Hs01_00122702 predicted 1824
13 SASI_Hs01_00122706 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369928 predicted 1802
2 SASI_Hs01_00075543 predicted 642
3 SASI_Hs01_00075544 predicted 627
4 SASI_Hs01_00075545 predicted 1549
5 SASI_Hs01_00075547 predicted 1292
6 SASI_Hs01_00075548 predicted 1541
7 SASI_Hs01_00075549 predicted 425
8 SASI_Hs01_00075551 predicted 876
9 SASI_Hs02_00369929 predicted 1400
10 SASI_Hs02_00369930 predicted 946
11 SASI_Hs01_00075542 predicted 2020
12 SASI_Hs01_00075546 predicted 1817
13 SASI_Hs01_00075550 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053994 predicted 2028
2 SASI_Rn01_00053995 predicted 2211
3 SASI_Rn01_00053996 predicted 1108
4 SASI_Rn01_00053998 predicted 988
5 SASI_Rn01_00053999 predicted 959
6 SASI_Rn01_00054000 predicted 1443
7 SASI_Rn01_00054001 predicted 1031
8 SASI_Rn02_00263931 predicted 2271
9 SASI_Rn02_00263932 predicted 1594
10 SASI_Rn01_00054003 predicted 688
11 SASI_Rn01_00053997 predicted 901
12 SASI_Rn01_00054002 predicted 2085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070473 predicted 1213
2 SASI_Mm01_00070474 predicted 1850
3 SASI_Mm01_00070475 predicted 2408
4 SASI_Mm01_00070476 predicted 1269
5 SASI_Mm01_00070477 predicted 1806
6 SASI_Mm01_00070478 predicted 1214
7 SASI_Mm01_00070479 predicted 1332
8 SASI_Mm01_00070480 predicted 2476
9 SASI_Mm01_00070481 predicted 2348
10 SASI_Mm01_00070482 predicted 2030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001530
VALIDATED
HIF1A MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-489s21c1
Sequence:CCGGCGGCGAAGTAAAGAATCTGAACTCGAGTTCAGATTCTTTACTTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-1168s21c1
Sequence:CCGGGTGATGAAAGAATTACCGAATCTCGAGATTCGGTAATTCTTTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-2791s21c1
Sequence:CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001530.3-3986s21c1
Sequence:CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-1612s21c1
Sequence:CCGGCCGCTGGAGACACAATCATATCTCGAGATATGATTGTGTCTCCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-2671s1c1
Sequence:CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-1492s1c1
Sequence:CCGGCCGCTGGAGACACAATCATATCTCGAGATATGATTGTGTCTCCAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-3867s1c1
Sequence:CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-369s1c1
Sequence:CCGGCGGCGAAGTAAAGAATCTGAACTCGAGTTCAGATTCTTTACTTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-1048s1c1
Sequence:CCGGGTGATGAAAGAATTACCGAATCTCGAGATTCGGTAATTCTTTCATCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001530
VALIDATED
HIF1A MISSION shRNA shRNA Plasmid DNA
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-489s21c1
Sequence:CCGGCGGCGAAGTAAAGAATCTGAACTCGAGTTCAGATTCTTTACTTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-1168s21c1
Sequence:CCGGGTGATGAAAGAATTACCGAATCTCGAGATTCGGTAATTCTTTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-2791s21c1
Sequence:CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001530.3-3986s21c1
Sequence:CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-1612s21c1
Sequence:CCGGCCGCTGGAGACACAATCATATCTCGAGATATGATTGTGTCTCCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-2671s1c1
Sequence:CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-1492s1c1
Sequence:CCGGCCGCTGGAGACACAATCATATCTCGAGATATGATTGTGTCTCCAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-3867s1c1
Sequence:CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-369s1c1
Sequence:CCGGCGGCGAAGTAAAGAATCTGAACTCGAGTTCAGATTCTTTACTTCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-1048s1c1
Sequence:CCGGGTGATGAAAGAATTACCGAATCTCGAGATTCGGTAATTCTTTCATCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001530
VALIDATED
HIF1A MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-489s21c1
Sequence:CCGGCGGCGAAGTAAAGAATCTGAACTCGAGTTCAGATTCTTTACTTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-1168s21c1
Sequence:CCGGGTGATGAAAGAATTACCGAATCTCGAGATTCGGTAATTCTTTCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-2791s21c1
Sequence:CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001530.3-3986s21c1
Sequence:CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001530.3-1612s21c1
Sequence:CCGGCCGCTGGAGACACAATCATATCTCGAGATATGATTGTGTCTCCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-2671s1c1
Sequence:CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-1492s1c1
Sequence:CCGGCCGCTGGAGACACAATCATATCTCGAGATATGATTGTGTCTCCAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-3867s1c1
Sequence:CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-369s1c1
Sequence:CCGGCGGCGAAGTAAAGAATCTGAACTCGAGTTCAGATTCTTTACTTCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001530.x-1048s1c1
Sequence:CCGGGTGATGAAAGAATTACCGAATCTCGAGATTCGGTAATTCTTTCATCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010431
VALIDATED
HIF1A MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-3739s21c1
Sequence:CCGGTATGCACTTTGTCGCTATTAACTCGAGTTAATAGCGACAAAGTGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-1864s21c1
Sequence:CCGGTGGATAGCGATATGGTCAATGCTCGAGCATTGACCATATCGCTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-987s21c1
Sequence:CCGGAGTCGACACAGCCTCGATATGCTCGAGCATATCGAGGCTGTGTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-933s21c1
Sequence:CCGGCCCATTCCTCATCCGTCAAATCTCGAGATTTGACGGATGAGGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1072s1c1
Sequence:CCGGGCCGCTCAATTTATGAATATTCTCGAGAATATTCATAAATTGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-2364s1c1
Sequence:CCGGGCCACTTTGAATCAAAGAAATCTCGAGATTTCTTTGATTCAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-2674s1c1
Sequence:CCGGCCAGTTACGATTGTGAAGTTACTCGAGTAACTTCACAATCGTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1842s1c1
Sequence:CCGGCCCAGTGAATATTGCTTTGATCTCGAGATCAAAGCAATATTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1384s1c1
Sequence:CCGGCCAAAGTTGAATCAGAGGATACTCGAGTATCCTCTGATTCAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010431.1-831s21c1
Sequence:CCGGCTTCACTGCACGGGCCATATTCTCGAGAATATGGCCCGTGCAGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010431
VALIDATED
HIF1A MISSION shRNA shRNA Plasmid DNA
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-3739s21c1
Sequence:CCGGTATGCACTTTGTCGCTATTAACTCGAGTTAATAGCGACAAAGTGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-1864s21c1
Sequence:CCGGTGGATAGCGATATGGTCAATGCTCGAGCATTGACCATATCGCTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-987s21c1
Sequence:CCGGAGTCGACACAGCCTCGATATGCTCGAGCATATCGAGGCTGTGTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-933s21c1
Sequence:CCGGCCCATTCCTCATCCGTCAAATCTCGAGATTTGACGGATGAGGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1072s1c1
Sequence:CCGGGCCGCTCAATTTATGAATATTCTCGAGAATATTCATAAATTGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-2364s1c1
Sequence:CCGGGCCACTTTGAATCAAAGAAATCTCGAGATTTCTTTGATTCAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-2674s1c1
Sequence:CCGGCCAGTTACGATTGTGAAGTTACTCGAGTAACTTCACAATCGTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1842s1c1
Sequence:CCGGCCCAGTGAATATTGCTTTGATCTCGAGATCAAAGCAATATTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1384s1c1
Sequence:CCGGCCAAAGTTGAATCAGAGGATACTCGAGTATCCTCTGATTCAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010431.1-831s21c1
Sequence:CCGGCTTCACTGCACGGGCCATATTCTCGAGAATATGGCCCGTGCAGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010431
VALIDATED
HIF1A MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-3739s21c1
Sequence:CCGGTATGCACTTTGTCGCTATTAACTCGAGTTAATAGCGACAAAGTGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-1864s21c1
Sequence:CCGGTGGATAGCGATATGGTCAATGCTCGAGCATTGACCATATCGCTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-987s21c1
Sequence:CCGGAGTCGACACAGCCTCGATATGCTCGAGCATATCGAGGCTGTGTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010431.1-933s21c1
Sequence:CCGGCCCATTCCTCATCCGTCAAATCTCGAGATTTGACGGATGAGGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1072s1c1
Sequence:CCGGGCCGCTCAATTTATGAATATTCTCGAGAATATTCATAAATTGAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-2364s1c1
Sequence:CCGGGCCACTTTGAATCAAAGAAATCTCGAGATTTCTTTGATTCAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-2674s1c1
Sequence:CCGGCCAGTTACGATTGTGAAGTTACTCGAGTAACTTCACAATCGTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1842s1c1
Sequence:CCGGCCCAGTGAATATTGCTTTGATCTCGAGATCAAAGCAATATTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010431.1-1384s1c1
Sequence:CCGGCCAAAGTTGAATCAGAGGATACTCGAGTATCCTCTGATTCAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010431.1-831s21c1
Sequence:CCGGCTTCACTGCACGGGCCATATTCTCGAGAATATGGCCCGTGCAGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)