EMAIL THIS PAGE TO A FRIEND

HIF1AN

hypoxia inducible factor 1, alpha subunit inhibitor

213 Gene Product Result for
Synonyms: FIH1
UniProtKB ID: Q9NWT6, D3DR69, Q5W147, Q969Q7, Q9NPV5
Gene ID:
Mouse(319594) hypoxia-inducible factor 1, alpha subunit inhibitor
Rat(309434) hypoxia-inducible factor 1, alpha subunit inhibitor
Zebrafish(373126) hypoxia-inducible factor 1, alpha subunit inhibitor
domestic cat(101091901) hypoxia inducible factor 1, alpha subunit inhibitor
cow(520864) hypoxia inducible factor 1, alpha subunit inhibitor
Horse(100070337) hypoxia inducible factor 1, alpha subunit inhibitor
dog(609221) hypoxia inducible factor 1, alpha subunit inhibitor
chicken(428952) hypoxia inducible factor 1, alpha subunit inhibitor
sheep(101122066) hypoxia inducible factor 1, alpha subunit inhibitor
domestic guinea pig(100723844) hypoxia inducible factor 1, alpha subunit inhibitor
naked mole-rat(101715790) hypoxia inducible factor 1, alpha subunit inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017902 Rosetta Predictions human pricing
NM_001113749 Rosetta Predictions rat pricing
NM_176958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016727 predicted 395
2 SASI_Hs01_00016728 predicted 1207
3 SASI_Hs01_00016726 predicted 543
4 SASI_Hs01_00016729 predicted 765
5 SASI_Hs01_00016731 predicted 721
6 SASI_Hs01_00016732 predicted 944
7 SASI_Hs02_00350876 predicted 1096
8 SASI_Hs01_00016734 predicted 451
9 SASI_Hs01_00016735 predicted 659
10 SASI_Hs02_00350877 predicted 1222
11 SASI_Hs01_00016730 predicted 962
12 SASI_Hs01_00016733 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251953 predicted 458
2 SASI_Rn02_00251954 predicted 297
3 SASI_Rn02_00251955 predicted 931
4 SASI_Rn02_00251956 predicted 597
5 SASI_Rn02_00251957 predicted 465
6 SASI_Rn02_00251958 predicted 240
7 SASI_Rn02_00251959 predicted 239
8 SASI_Rn02_00251960 predicted 776
9 SASI_Rn02_00251961 predicted 646
10 SASI_Rn02_00251962 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113420 predicted 310
2 SASI_Mm01_00113421 predicted 1154
3 SASI_Mm01_00113422 predicted 890
4 SASI_Mm01_00113423 predicted 220
5 SASI_Mm01_00113424 predicted 253
6 SASI_Mm02_00346860 predicted 250
7 SASI_Mm01_00113425 predicted 1044
8 SASI_Mm01_00113426 predicted 569
9 SASI_Mm01_00113427 predicted 655
10 SASI_Mm01_00113428 predicted 383
11 SASI_Mm01_00113429 predicted 969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176958
HIF1AN MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible factor 1, alpha subunit inhibitor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-294s1c1
Sequence:CCGGCCAGCACCCATAAGTTCTTATCTCGAGATAAGAACTTATGGGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-478s1c1
Sequence:CCGGGAAGATTGTCATGGACTTCTTCTCGAGAAGAAGTCCATGACAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-250s1c1
Sequence:CCGGCCTGCAAGAGAATATTGGCAACTCGAGTTGCCAATATTCTCTTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-268s1c1
Sequence:CCGGCAACGGAGATTTCTCTGTGTACTCGAGTACACAGAGAAATCTCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176958
HIF1AN MISSION shRNA shRNA Plasmid DNA
hypoxia inducible factor 1, alpha subunit inhibitor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-294s1c1
Sequence:CCGGCCAGCACCCATAAGTTCTTATCTCGAGATAAGAACTTATGGGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-478s1c1
Sequence:CCGGGAAGATTGTCATGGACTTCTTCTCGAGAAGAAGTCCATGACAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-250s1c1
Sequence:CCGGCCTGCAAGAGAATATTGGCAACTCGAGTTGCCAATATTCTCTTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-268s1c1
Sequence:CCGGCAACGGAGATTTCTCTGTGTACTCGAGTACACAGAGAAATCTCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176958
HIF1AN MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible factor 1, alpha subunit inhibitor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-294s1c1
Sequence:CCGGCCAGCACCCATAAGTTCTTATCTCGAGATAAGAACTTATGGGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-478s1c1
Sequence:CCGGGAAGATTGTCATGGACTTCTTCTCGAGAAGAAGTCCATGACAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-250s1c1
Sequence:CCGGCCTGCAAGAGAATATTGGCAACTCGAGTTGCCAATATTCTCTTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176958.2-268s1c1
Sequence:CCGGCAACGGAGATTTCTCTGTGTACTCGAGTACACAGAGAAATCTCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017902
VALIDATED
HIF1AN MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible factor 1, alpha subunit inhibitor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-1031s1c1
Sequence:CCGGGCCCTTGTTGAACACAATGATCTCGAGATCATTGTGTTCAACAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017902.1-118s1c1
Sequence:CCGGGCAGTTATAGCTTCCCGACTACTCGAGTAGTCGGGAAGCTATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-932s1c1
Sequence:CCGGGAGAATTGAATATCCTCTCAACTCGAGTTGAGAGGATATTCAATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-238s1c1
Sequence:CCGGCCCTGAAATGGGACCTTGAATCTCGAGATTCAAGGTCCCATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017902.1-818s1c1
Sequence:CCGGCCCTGGTGATGTTCTTTACATCTCGAGATGTAAAGAACATCACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-568s21c1
Sequence:CCGGTTTAACTGGAACTGGATTAATCTCGAGATTAATCCAGTTCCAGTTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-819s21c1
Sequence:CCGGCTACGAGAGGTTCCCTAATTTCTCGAGAAATTAGGGAACCTCTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-160s21c1
Sequence:CCGGGAATCCCAGTTGCGCAGTTATCTCGAGATAACTGCGCAACTGGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017902.2-4789s21c1
Sequence:CCGGTGAAGCAACCAGAGGTTATAACTCGAGTTATAACCTCTGGTTGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-912s21c1
Sequence:CCGGTCACATAGAGTCATTACTAAACTCGAGTTTAGTAATGACTCTATGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017902
VALIDATED
HIF1AN MISSION shRNA shRNA Plasmid DNA
hypoxia inducible factor 1, alpha subunit inhibitor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-1031s1c1
Sequence:CCGGGCCCTTGTTGAACACAATGATCTCGAGATCATTGTGTTCAACAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017902.1-118s1c1
Sequence:CCGGGCAGTTATAGCTTCCCGACTACTCGAGTAGTCGGGAAGCTATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-932s1c1
Sequence:CCGGGAGAATTGAATATCCTCTCAACTCGAGTTGAGAGGATATTCAATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-238s1c1
Sequence:CCGGCCCTGAAATGGGACCTTGAATCTCGAGATTCAAGGTCCCATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017902.1-818s1c1
Sequence:CCGGCCCTGGTGATGTTCTTTACATCTCGAGATGTAAAGAACATCACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-568s21c1
Sequence:CCGGTTTAACTGGAACTGGATTAATCTCGAGATTAATCCAGTTCCAGTTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-819s21c1
Sequence:CCGGCTACGAGAGGTTCCCTAATTTCTCGAGAAATTAGGGAACCTCTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-160s21c1
Sequence:CCGGGAATCCCAGTTGCGCAGTTATCTCGAGATAACTGCGCAACTGGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017902.2-4789s21c1
Sequence:CCGGTGAAGCAACCAGAGGTTATAACTCGAGTTATAACCTCTGGTTGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-912s21c1
Sequence:CCGGTCACATAGAGTCATTACTAAACTCGAGTTTAGTAATGACTCTATGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017902
VALIDATED
HIF1AN MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible factor 1, alpha subunit inhibitor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-1031s1c1
Sequence:CCGGGCCCTTGTTGAACACAATGATCTCGAGATCATTGTGTTCAACAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017902.1-118s1c1
Sequence:CCGGGCAGTTATAGCTTCCCGACTACTCGAGTAGTCGGGAAGCTATAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-932s1c1
Sequence:CCGGGAGAATTGAATATCCTCTCAACTCGAGTTGAGAGGATATTCAATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017902.1-238s1c1
Sequence:CCGGCCCTGAAATGGGACCTTGAATCTCGAGATTCAAGGTCCCATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017902.1-818s1c1
Sequence:CCGGCCCTGGTGATGTTCTTTACATCTCGAGATGTAAAGAACATCACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-568s21c1
Sequence:CCGGTTTAACTGGAACTGGATTAATCTCGAGATTAATCCAGTTCCAGTTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-819s21c1
Sequence:CCGGCTACGAGAGGTTCCCTAATTTCTCGAGAAATTAGGGAACCTCTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-160s21c1
Sequence:CCGGGAATCCCAGTTGCGCAGTTATCTCGAGATAACTGCGCAACTGGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017902.2-4789s21c1
Sequence:CCGGTGAAGCAACCAGAGGTTATAACTCGAGTTATAACCTCTGGTTGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017902.2-912s21c1
Sequence:CCGGTCACATAGAGTCATTACTAAACTCGAGTTTAGTAATGACTCTATGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)