EMAIL THIS PAGE TO A FRIEND

HIGD1A

HIG1 hypoxia inducible domain family, member 1A

73 Gene Product Result for
Synonyms: HIG1 RCF1a
UniProtKB ID: Q9Y241, Q9UFZ2
Gene ID:
Mouse(56295) HIG1 domain family, member 1A
Rat(140937) HIG1 hypoxia inducible domain family, member 1A
chicken(768335) HIG1 hypoxia inducible domain family, member 1A
cow(786015) HIG1 hypoxia inducible domain family, member 1A
domestic cat(101094620) HIG1 hypoxia inducible domain family, member 1A
dog(477037) HIG1 hypoxia inducible domain family, member 1A
sheep(101117970) HIG1 hypoxia inducible domain family, member 1A
domestic guinea pig(100713313) HIG1 hypoxia inducible domain family, member 1A
naked mole-rat(101713147) HIG1 hypoxia inducible domain family, member 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043336 Anti-HIGD1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB3500685 Anti-HIGD1A antibody produced in rabbit affinity isolated antibody human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099668 Rosetta Predictions human pricing
NM_001099669 Rosetta Predictions human pricing
NM_014056 Rosetta Predictions human pricing
NM_080902 Rosetta Predictions rat pricing
NM_019814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320956 predicted 524
2 SASI_Hs02_00320957 predicted 527
3 SASI_Hs02_00320958 predicted 518
4 SASI_Hs02_00320959 predicted 901
5 SASI_Hs02_00320960 predicted 796
6 SASI_Hs02_00320961 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320962 predicted 380
2 SASI_Hs02_00320963 predicted 377
3 SASI_Hs02_00320964 predicted 368
4 SASI_Hs02_00320965 predicted 758
5 SASI_Hs02_00320966 predicted 654
6 SASI_Hs02_00320967 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153716 predicted 354
2 SASI_Hs01_00153718 predicted 355
3 SASI_Hs01_00153720 predicted 349
4 SASI_Hs02_00345070 predicted 731
5 SASI_Hs01_00153717 predicted 624
6 SASI_Hs01_00153719 predicted 445
7 SASI_Hs01_00153721 predicted 530
8 SASI_Hs01_00153722 predicted 413
9 SASI_Hs01_00153723 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077565 predicted 505
2 SASI_Rn01_00077566 predicted 406
3 SASI_Rn01_00077567 predicted 466
4 SASI_Rn01_00077569 predicted 424
5 SASI_Rn01_00077570 predicted 316
6 SASI_Rn01_00077571 predicted 386
7 SASI_Rn01_00077572 predicted 236
8 SASI_Rn01_00077573 predicted 303
9 SASI_Rn01_00077574 predicted 516
10 SASI_Rn02_00267358 predicted 521
11 SASI_Rn01_00077568 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325086 predicted 994
2 SASI_Mm02_00325087 predicted 893
3 SASI_Mm01_00165439 predicted 946
4 SASI_Mm02_00325088 predicted 760
5 SASI_Mm02_00325089 predicted 848
6 SASI_Mm01_00165443 predicted 620
7 SASI_Mm02_00325090 predicted 1019
8 SASI_Mm01_00165444 predicted 671
9 SASI_Mm01_00165447 predicted 928
10 SASI_Mm02_00325091 predicted 936
11 SASI_Mm01_00165438 predicted 673
12 SASI_Mm01_00165440 predicted 578
13 SASI_Mm01_00165441 predicted 246
14 SASI_Mm01_00165442 predicted 476
15 SASI_Mm01_00165445 predicted 375
16 SASI_Mm01_00165446 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014056
VALIDATED
HIGD1A MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-207s1c1
Sequence:CCGGGCAATTGTTGCATATGGATTACTCGAGTAATCCATATGCAACAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-291s1c1
Sequence:CCGGGCCCAAGGCTTTGTTGTAGGACTCGAGTCCTACAACAAAGCCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-331s1c1
Sequence:CCGGGCTATTCCATGTATCGGGAATCTCGAGATTCCCGATACATGGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-313s1c1
Sequence:CCGGCAATGACTGTTGGTATGGGCTCTCGAGAGCCCATACCAACAGTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-294s1c1
Sequence:CCGGCAAGGCTTTGTTGTAGGAGCACTCGAGTGCTCCTACAACAAAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-174s1c1
Sequence:CCGGCCATTCGTACCCGTTGGAATACTCGAGTATTCCAACGGGTACGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-162s1c1
Sequence:CCGGGCTAAAGAGGCACCATTCGTACTCGAGTACGAATGGTGCCTCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-303s1c1
Sequence:CCGGGTTGTAGGAGCAATGACTGTTCTCGAGAACAGTCATTGCTCCTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014056.1-205s1c1
Sequence:CCGGCAGCAATTGTTGCATATGGATCTCGAGATCCATATGCAACAATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014056.1-1083s1c1
Sequence:CCGGGCAAAGGTAAATGAACACGTTCTCGAGAACGTGTTCATTTACCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014056
VALIDATED
HIGD1A MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-207s1c1
Sequence:CCGGGCAATTGTTGCATATGGATTACTCGAGTAATCCATATGCAACAATTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000122388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-291s1c1
Sequence:CCGGGCCCAAGGCTTTGTTGTAGGACTCGAGTCCTACAACAAAGCCTTGGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000143367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-331s1c1
Sequence:CCGGGCTATTCCATGTATCGGGAATCTCGAGATTCCCGATACATGGAATAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000140960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-313s1c1
Sequence:CCGGCAATGACTGTTGGTATGGGCTCTCGAGAGCCCATACCAACAGTCATTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000141046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-294s1c1
Sequence:CCGGCAAGGCTTTGTTGTAGGAGCACTCGAGTGCTCCTACAACAAAGCCTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000141307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-174s1c1
Sequence:CCGGCCATTCGTACCCGTTGGAATACTCGAGTATTCCAACGGGTACGAATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000142458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-162s1c1
Sequence:CCGGGCTAAAGAGGCACCATTCGTACTCGAGTACGAATGGTGCCTCTTTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000143716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-303s1c1
Sequence:CCGGGTTGTAGGAGCAATGACTGTTCTCGAGAACAGTCATTGCTCCTACAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000144210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014056.1-205s1c1
Sequence:CCGGCAGCAATTGTTGCATATGGATCTCGAGATCCATATGCAACAATTGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000145347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014056.1-1083s1c1
Sequence:CCGGGCAAAGGTAAATGAACACGTTCTCGAGAACGTGTTCATTTACCTTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014056
VALIDATED
HIGD1A MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 1A
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000121999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-207s1c1
Sequence:CCGGGCAATTGTTGCATATGGATTACTCGAGTAATCCATATGCAACAATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-291s1c1
Sequence:CCGGGCCCAAGGCTTTGTTGTAGGACTCGAGTCCTACAACAAAGCCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-331s1c1
Sequence:CCGGGCTATTCCATGTATCGGGAATCTCGAGATTCCCGATACATGGAATAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-313s1c1
Sequence:CCGGCAATGACTGTTGGTATGGGCTCTCGAGAGCCCATACCAACAGTCATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-294s1c1
Sequence:CCGGCAAGGCTTTGTTGTAGGAGCACTCGAGTGCTCCTACAACAAAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-174s1c1
Sequence:CCGGCCATTCGTACCCGTTGGAATACTCGAGTATTCCAACGGGTACGAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-162s1c1
Sequence:CCGGGCTAAAGAGGCACCATTCGTACTCGAGTACGAATGGTGCCTCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014056.1-303s1c1
Sequence:CCGGGTTGTAGGAGCAATGACTGTTCTCGAGAACAGTCATTGCTCCTACAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014056.1-205s1c1
Sequence:CCGGCAGCAATTGTTGCATATGGATCTCGAGATCCATATGCAACAATTGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014056.1-1083s1c1
Sequence:CCGGGCAAAGGTAAATGAACACGTTCTCGAGAACGTGTTCATTTACCTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019814
VALIDATED
HIGD1A MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 1A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-1052s21c1
Sequence:CCGGTGTGATGAAAGTCATTGTAAGCTCGAGCTTACAATGACTTTCATCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-282s1c1
Sequence:CCGGGAAGAGCAGAGGAAATACAAACTCGAGTTTGTATTTCCTCTGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-1153s21c1
Sequence:CCGGGTTTGCTCTGGTTCGTTTATTCTCGAGAATAAACGAACCAGAGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-900s21c1
Sequence:CCGGACGGTATTGAATATTGGTTTACTCGAGTAAACCAATATTCAATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019814.4-655s21c1
Sequence:CCGGGAAGAGCAGAGGAAATACAAACTCGAGTTTGTATTTCCTCTGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019814.2-285s1c1
Sequence:CCGGGAGCAGAGGAAATACAAAGATCTCGAGATCTTTGTATTTCCTCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019814.2-568s1c1
Sequence:CCGGGCCAAATTGTTAGTGACTGATCTCGAGATCAGTCACTAACAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-303s1c1
Sequence:CCGGGATGTCCATTCACTTGATCCACTCGAGTGGATCAAGTGAATGGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019814.2-569s1c1
Sequence:CCGGCCAAATTGTTAGTGACTGATTCTCGAGAATCAGTCACTAACAATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-287s1c1
Sequence:CCGGGCAGAGGAAATACAAAGATGTCTCGAGACATCTTTGTATTTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019814.4-676s21c1
Sequence:CCGGGATGTCCATTCACTTGATCCACTCGAGTGGATCAAGTGAATGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019814
VALIDATED
HIGD1A MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 1A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-1052s21c1
Sequence:CCGGTGTGATGAAAGTCATTGTAAGCTCGAGCTTACAATGACTTTCATCACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000176154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-282s1c1
Sequence:CCGGGAAGAGCAGAGGAAATACAAACTCGAGTTTGTATTTCCTCTGCTCTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-1153s21c1
Sequence:CCGGGTTTGCTCTGGTTCGTTTATTCTCGAGAATAAACGAACCAGAGCAAACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-900s21c1
Sequence:CCGGACGGTATTGAATATTGGTTTACTCGAGTAAACCAATATTCAATACCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019814.4-655s21c1
Sequence:CCGGGAAGAGCAGAGGAAATACAAACTCGAGTTTGTATTTCCTCTGCTCTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019814.2-285s1c1
Sequence:CCGGGAGCAGAGGAAATACAAAGATCTCGAGATCTTTGTATTTCCTCTGCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000175726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019814.2-568s1c1
Sequence:CCGGGCCAAATTGTTAGTGACTGATCTCGAGATCAGTCACTAACAATTTGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-303s1c1
Sequence:CCGGGATGTCCATTCACTTGATCCACTCGAGTGGATCAAGTGAATGGACATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000174261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019814.2-569s1c1
Sequence:CCGGCCAAATTGTTAGTGACTGATTCTCGAGAATCAGTCACTAACAATTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000175725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-287s1c1
Sequence:CCGGGCAGAGGAAATACAAAGATGTCTCGAGACATCTTTGTATTTCCTCTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019814.4-676s21c1
Sequence:CCGGGATGTCCATTCACTTGATCCACTCGAGTGGATCAAGTGAATGGACATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019814
VALIDATED
HIGD1A MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 1A
Mouse
11 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000277393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-1052s21c1
Sequence:CCGGTGTGATGAAAGTCATTGTAAGCTCGAGCTTACAATGACTTTCATCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-282s1c1
Sequence:CCGGGAAGAGCAGAGGAAATACAAACTCGAGTTTGTATTTCCTCTGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-1153s21c1
Sequence:CCGGGTTTGCTCTGGTTCGTTTATTCTCGAGAATAAACGAACCAGAGCAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019814.4-900s21c1
Sequence:CCGGACGGTATTGAATATTGGTTTACTCGAGTAAACCAATATTCAATACCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019814.4-655s21c1
Sequence:CCGGGAAGAGCAGAGGAAATACAAACTCGAGTTTGTATTTCCTCTGCTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019814.2-285s1c1
Sequence:CCGGGAGCAGAGGAAATACAAAGATCTCGAGATCTTTGTATTTCCTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019814.2-568s1c1
Sequence:CCGGGCCAAATTGTTAGTGACTGATCTCGAGATCAGTCACTAACAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-303s1c1
Sequence:CCGGGATGTCCATTCACTTGATCCACTCGAGTGGATCAAGTGAATGGACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019814.2-569s1c1
Sequence:CCGGCCAAATTGTTAGTGACTGATTCTCGAGAATCAGTCACTAACAATTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019814.2-287s1c1
Sequence:CCGGGCAGAGGAAATACAAAGATGTCTCGAGACATCTTTGTATTTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019814.4-676s21c1
Sequence:CCGGGATGTCCATTCACTTGATCCACTCGAGTGGATCAAGTGAATGGACATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)