EMAIL THIS PAGE TO A FRIEND

HIGD1C

HIG1 hypoxia inducible domain family, member 1C

26 Gene Product Result for
Synonyms: GM921
UniProtKB ID: A8MV81
Gene ID:
Mouse(380975) HIG1 domain family, member 1C
sheep(101117405) HIG1 hypoxia inducible domain family, member 1C
domestic guinea pig(101788477) HIG1 hypoxia inducible domain family, member 1C
cow(100848305) HIG1 hypoxia inducible domain family, member 1C
domestic cat(101088941) HIG1 hypoxia inducible domain family, member 1C
dog(486544) HIG1 hypoxia inducible domain family, member 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305917 ANTI-HIGD1C(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001109619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109619 Rosetta Predictions human pricing
NM_001002900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324673 predicted 123
2 SASI_Hs02_00324674 predicted 35
3 SASI_Hs02_00324675 predicted 259
4 SASI_Hs02_00324676 predicted 213
5 SASI_Hs02_00324677 predicted 116
6 SASI_Hs02_00324678 predicted 180
7 SASI_Hs02_00324679 predicted 48
8 SASI_Hs02_00324680 predicted 90
9 SASI_Hs02_00324681 predicted 189
10 SASI_Hs02_00324682 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190649 predicted 258
2 SASI_Mm01_00190650 predicted 262
3 SASI_Mm01_00190651 predicted 195
4 SASI_Mm02_00286312 predicted 276
5 SASI_Mm01_00190652 predicted 275
6 SASI_Mm01_00190653 predicted 207
7 SASI_Mm01_00190654 predicted 275
8 SASI_Mm01_00190655 predicted 272
9 SASI_Mm01_00190656 predicted 281
10 SASI_Mm01_00190657 predicted 281
11 SASI_Mm01_00190658 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109619
HIGD1C MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 1C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-226s21c1
Sequence:CCGGCTAGGTGTTCTCTATTCTATGCTCGAGCATAGAATAGAGAACACCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-253s21c1
Sequence:CCGGGATTACATTAGACCACGATTCCTCGAGGAATCGTGGTCTAATGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-79s21c1
Sequence:CCGGCCCTTTGTCCCTATAGGTATACTCGAGTATACCTATAGGGACAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-123s21c1
Sequence:CCGGCTGTGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-30s21c1
Sequence:CCGGTGAGGATGAAGGCCAATTATCCTCGAGGATAATTGGCCTTCATCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109619
HIGD1C MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 1C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-226s21c1
Sequence:CCGGCTAGGTGTTCTCTATTCTATGCTCGAGCATAGAATAGAGAACACCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-253s21c1
Sequence:CCGGGATTACATTAGACCACGATTCCTCGAGGAATCGTGGTCTAATGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-79s21c1
Sequence:CCGGCCCTTTGTCCCTATAGGTATACTCGAGTATACCTATAGGGACAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-123s21c1
Sequence:CCGGCTGTGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-30s21c1
Sequence:CCGGTGAGGATGAAGGCCAATTATCCTCGAGGATAATTGGCCTTCATCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109619
HIGD1C MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 1C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-226s21c1
Sequence:CCGGCTAGGTGTTCTCTATTCTATGCTCGAGCATAGAATAGAGAACACCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-253s21c1
Sequence:CCGGGATTACATTAGACCACGATTCCTCGAGGAATCGTGGTCTAATGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-79s21c1
Sequence:CCGGCCCTTTGTCCCTATAGGTATACTCGAGTATACCTATAGGGACAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-123s21c1
Sequence:CCGGCTGTGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109619.1-30s21c1
Sequence:CCGGTGAGGATGAAGGCCAATTATCCTCGAGGATAATTGGCCTTCATCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002900
HIGD1C MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 1C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-171s1c1
Sequence:CCGGCTACGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-264s21c1
Sequence:CCGGAGCCGTGACTCTAGGTGTTCTCTCGAGAGAACACCTAGAGTCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-303s1c1
Sequence:CCGGCTATATCAGACCTCGGTTCTTCTCGAGAAGAACCGAGGTCTGATATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-186s1c1
Sequence:CCGGGCTAAATTCCAGAAGAGAGCACTCGAGTGCTCTCTTCTGGAATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-171s21c1
Sequence:CCGGCTACGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-289s21c1
Sequence:CCGGTCTATGTATAAGGACTATATCCTCGAGGATATAGTCCTTATACATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-95s21c1
Sequence:CCGGTGTCCCGACTCCTCCGGAAATCTCGAGATTTCCGGAGGAGTCGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-311s21c1
Sequence:CCGGGACCTCGGTTCTTCAATGTACCTCGAGGTACATTGAAGAACCGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002900
HIGD1C MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 1C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-171s1c1
Sequence:CCGGCTACGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-264s21c1
Sequence:CCGGAGCCGTGACTCTAGGTGTTCTCTCGAGAGAACACCTAGAGTCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-303s1c1
Sequence:CCGGCTATATCAGACCTCGGTTCTTCTCGAGAAGAACCGAGGTCTGATATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-186s1c1
Sequence:CCGGGCTAAATTCCAGAAGAGAGCACTCGAGTGCTCTCTTCTGGAATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-171s21c1
Sequence:CCGGCTACGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-289s21c1
Sequence:CCGGTCTATGTATAAGGACTATATCCTCGAGGATATAGTCCTTATACATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-95s21c1
Sequence:CCGGTGTCCCGACTCCTCCGGAAATCTCGAGATTTCCGGAGGAGTCGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-311s21c1
Sequence:CCGGGACCTCGGTTCTTCAATGTACCTCGAGGTACATTGAAGAACCGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002900
HIGD1C MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 1C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-171s1c1
Sequence:CCGGCTACGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-264s21c1
Sequence:CCGGAGCCGTGACTCTAGGTGTTCTCTCGAGAGAACACCTAGAGTCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-303s1c1
Sequence:CCGGCTATATCAGACCTCGGTTCTTCTCGAGAAGAACCGAGGTCTGATATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002900.1-186s1c1
Sequence:CCGGGCTAAATTCCAGAAGAGAGCACTCGAGTGCTCTCTTCTGGAATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-171s21c1
Sequence:CCGGCTACGGTCTTTACAAGCTAAACTCGAGTTTAGCTTGTAAAGACCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-289s21c1
Sequence:CCGGTCTATGTATAAGGACTATATCCTCGAGGATATAGTCCTTATACATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-95s21c1
Sequence:CCGGTGTCCCGACTCCTCCGGAAATCTCGAGATTTCCGGAGGAGTCGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002900.1-311s21c1
Sequence:CCGGGACCTCGGTTCTTCAATGTACCTCGAGGTACATTGAAGAACCGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)