EMAIL THIS PAGE TO A FRIEND

HIGD2A

HIG1 hypoxia inducible domain family, member 2A

48 Gene Product Result for
Synonyms: RCF1b
UniProtKB ID: Q9BW72
Gene ID:
Mouse(67044) HIG1 domain family, member 2A
Rat(290999) HIG1 hypoxia inducible domain family, member 2A
sheep(101117073) HIG1 hypoxia inducible domain family, member 2A
Zebrafish(550334) HIG1 hypoxia inducible domain family, member 2A
domestic cat(101082208) HIG1 hypoxia inducible domain family, member 2A
dog(479281) HIG1 hypoxia inducible domain family, member 2A
cow(506420) HIG1 hypoxia inducible domain family, member 2A
chicken(416227) HIG1 hypoxia inducible domain family, member 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138820 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138820 Rosetta Predictions human pricing
NM_001106102 Rosetta Predictions rat pricing
NM_025933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100502 predicted 364
2 SASI_Hs01_00100503 predicted 376
3 SASI_Hs01_00100504 predicted 272
4 SASI_Hs01_00100505 predicted 205
5 SASI_Hs01_00100506 predicted 285
6 SASI_Hs01_00100507 predicted 363
7 SASI_Hs01_00100508 predicted 363
8 SASI_Hs01_00100509 predicted 217
9 SASI_Hs01_00100510 predicted 207
10 SASI_Hs02_00363990 predicted 320
11 SASI_Hs01_00100501 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215642 predicted 245
2 SASI_Rn02_00215643 predicted 252
3 SASI_Rn02_00215644 predicted 249
4 SASI_Rn02_00215645 predicted 343
5 SASI_Rn02_00215646 predicted 300
6 SASI_Rn02_00215647 predicted 355
7 SASI_Rn02_00215648 predicted 347
8 SASI_Rn02_00215649 predicted 273
9 SASI_Rn02_00215650 predicted 209
10 SASI_Rn02_00215651 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186376 predicted 244
2 SASI_Mm01_00186377 predicted 296
3 SASI_Mm01_00186378 predicted 240
4 SASI_Mm01_00186379 predicted 274
5 SASI_Mm01_00186380 predicted 341
6 SASI_Mm01_00186381 predicted 349
7 SASI_Mm01_00186382 predicted 277
8 SASI_Mm01_00186383 predicted 335
9 SASI_Mm01_00186384 predicted 207
10 SASI_Mm02_00329321 predicted 208
11 SASI_Mm01_00186375 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025933
VALIDATED
HIGD2A MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 2A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025933.3-376s21c1
Sequence:CCGGCGCCATGGAAACCATTACAAACTCGAGTTTGTAATGGTTTCCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-168s21c1
Sequence:CCGGGAGAACCCAATGGTGCCTATACTCGAGTATAGGCACCATTGGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-288s21c1
Sequence:CCGGGCACAGGGTTTCACGGTCGTACTCGAGTACGACCGTGAAACCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-323s21c1
Sequence:CCGGGTTAGCGGCATCTGCTATGAACTCGAGTTCATAGCAGATGCCGCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025933.1-377s1c1
Sequence:CCGGCGCCATGGAAACCATTACAAACTCGAGTTTGTAATGGTTTCCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025933.1-331s1c1
Sequence:CCGGGCATCTGCTATGAAGTCTCAACTCGAGTTGAGACTTCATAGCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-169s1c1
Sequence:CCGGGAGAACCCAATGGTGCCTATACTCGAGTATAGGCACCATTGGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-324s1c1
Sequence:CCGGGTTAGCGGCATCTGCTATGAACTCGAGTTCATAGCAGATGCCGCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-289s1c1
Sequence:CCGGGCACAGGGTTTCACGGTCGTACTCGAGTACGACCGTGAAACCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025933
VALIDATED
HIGD2A MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 2A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025933.3-376s21c1
Sequence:CCGGCGCCATGGAAACCATTACAAACTCGAGTTTGTAATGGTTTCCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-168s21c1
Sequence:CCGGGAGAACCCAATGGTGCCTATACTCGAGTATAGGCACCATTGGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-288s21c1
Sequence:CCGGGCACAGGGTTTCACGGTCGTACTCGAGTACGACCGTGAAACCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-323s21c1
Sequence:CCGGGTTAGCGGCATCTGCTATGAACTCGAGTTCATAGCAGATGCCGCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025933.1-377s1c1
Sequence:CCGGCGCCATGGAAACCATTACAAACTCGAGTTTGTAATGGTTTCCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025933.1-331s1c1
Sequence:CCGGGCATCTGCTATGAAGTCTCAACTCGAGTTGAGACTTCATAGCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-169s1c1
Sequence:CCGGGAGAACCCAATGGTGCCTATACTCGAGTATAGGCACCATTGGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-324s1c1
Sequence:CCGGGTTAGCGGCATCTGCTATGAACTCGAGTTCATAGCAGATGCCGCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-289s1c1
Sequence:CCGGGCACAGGGTTTCACGGTCGTACTCGAGTACGACCGTGAAACCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025933
VALIDATED
HIGD2A MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 2A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025933.3-376s21c1
Sequence:CCGGCGCCATGGAAACCATTACAAACTCGAGTTTGTAATGGTTTCCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-168s21c1
Sequence:CCGGGAGAACCCAATGGTGCCTATACTCGAGTATAGGCACCATTGGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-288s21c1
Sequence:CCGGGCACAGGGTTTCACGGTCGTACTCGAGTACGACCGTGAAACCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025933.3-323s21c1
Sequence:CCGGGTTAGCGGCATCTGCTATGAACTCGAGTTCATAGCAGATGCCGCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025933.1-377s1c1
Sequence:CCGGCGCCATGGAAACCATTACAAACTCGAGTTTGTAATGGTTTCCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025933.1-331s1c1
Sequence:CCGGGCATCTGCTATGAAGTCTCAACTCGAGTTGAGACTTCATAGCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-169s1c1
Sequence:CCGGGAGAACCCAATGGTGCCTATACTCGAGTATAGGCACCATTGGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-324s1c1
Sequence:CCGGGTTAGCGGCATCTGCTATGAACTCGAGTTCATAGCAGATGCCGCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025933.1-289s1c1
Sequence:CCGGGCACAGGGTTTCACGGTCGTACTCGAGTACGACCGTGAAACCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138820
VALIDATED
HIGD2A MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 2A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138820.2-372s21c1
Sequence:CCGGCCTTGAAAGCTCCGCAGAAATCTCGAGATTTCTGCGGAGCTTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-339s21c1
Sequence:CCGGCTATGAAGTCTCGACCCTAAGCTCGAGCTTAGGGTCGAGACTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138820.2-298s21c1
Sequence:CCGGTTTCACGGTCGCAGCCATCTTCTCGAGAAGATGGCTGCGACCGTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-124s21c1
Sequence:CCGGCAGGAATCCAGAGAGTTTCAACTCGAGTTGAAACTCTCTGGATTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-79s21c1
Sequence:CCGGACCATCGAAGCCTCCAGTCATCTCGAGATGACTGGAGGCTTCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138820.2-127s1c1
Sequence:CCGGGAATCCAGAGAGTTTCAAGGACTCGAGTCCTTGAAACTCTCTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138820
VALIDATED
HIGD2A MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 2A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138820.2-372s21c1
Sequence:CCGGCCTTGAAAGCTCCGCAGAAATCTCGAGATTTCTGCGGAGCTTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-339s21c1
Sequence:CCGGCTATGAAGTCTCGACCCTAAGCTCGAGCTTAGGGTCGAGACTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138820.2-298s21c1
Sequence:CCGGTTTCACGGTCGCAGCCATCTTCTCGAGAAGATGGCTGCGACCGTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-124s21c1
Sequence:CCGGCAGGAATCCAGAGAGTTTCAACTCGAGTTGAAACTCTCTGGATTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-79s21c1
Sequence:CCGGACCATCGAAGCCTCCAGTCATCTCGAGATGACTGGAGGCTTCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138820.2-127s1c1
Sequence:CCGGGAATCCAGAGAGTTTCAAGGACTCGAGTCCTTGAAACTCTCTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138820
VALIDATED
HIGD2A MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 2A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138820.2-372s21c1
Sequence:CCGGCCTTGAAAGCTCCGCAGAAATCTCGAGATTTCTGCGGAGCTTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-339s21c1
Sequence:CCGGCTATGAAGTCTCGACCCTAAGCTCGAGCTTAGGGTCGAGACTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138820.2-298s21c1
Sequence:CCGGTTTCACGGTCGCAGCCATCTTCTCGAGAAGATGGCTGCGACCGTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-124s21c1
Sequence:CCGGCAGGAATCCAGAGAGTTTCAACTCGAGTTGAAACTCTCTGGATTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138820.2-79s21c1
Sequence:CCGGACCATCGAAGCCTCCAGTCATCTCGAGATGACTGGAGGCTTCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138820.2-127s1c1
Sequence:CCGGGAATCCAGAGAGTTTCAAGGACTCGAGTCCTTGAAACTCTCTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)