EMAIL THIS PAGE TO A FRIEND

HILPDA

hypoxia inducible lipid droplet-associated

60 Gene Product Result for
Synonyms: C7orf68 HIG-2 HIG2
UniProtKB ID: Q9Y5L2, A4D0Z5, Q52LY5, Q53HJ7
Gene ID:
Mouse(69573) hypoxia inducible lipid droplet associated
Rat(100361568) hypoxia inducible lipid droplet-associated
sheep(101104395) hypoxia inducible lipid droplet-associated
domestic guinea pig(100728448) hypoxia inducible lipid droplet-associated
naked mole-rat(101720002) hypoxia inducible lipid droplet-associated
dog(100688487) hypoxia inducible lipid droplet-associated
domestic cat(101084528) hypoxia inducible lipid droplet-associated
cow(100125928) hypoxia inducible lipid droplet-associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098786 Rosetta Predictions human pricing
NM_013332 Rosetta Predictions human pricing
NM_023516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319819 predicted 826
2 SASI_Hs02_00319820 predicted 452
3 SASI_Hs02_00319821 predicted 215
4 SASI_Hs02_00319822 predicted 335
5 SASI_Hs02_00319823 predicted 364
6 SASI_Hs02_00319824 predicted 823
7 SASI_Hs02_00319825 predicted 391
8 SASI_Hs02_00319826 predicted 344
9 SASI_Hs02_00319827 predicted 411
10 SASI_Hs02_00319828 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240722 predicted 939
2 SASI_Hs01_00240723 predicted 563
3 SASI_Hs02_00344635 predicted 329
4 SASI_Hs01_00240725 predicted 448
5 SASI_Hs02_00344636 predicted 482
6 SASI_Hs02_00344637 predicted 938
7 SASI_Hs02_00344638 predicted 506
8 SASI_Hs02_00344639 predicted 459
9 SASI_Hs02_00344640 predicted 519
10 SASI_Hs02_00344641 predicted 533
11 SASI_Hs01_00240716 predicted 286
12 SASI_Hs01_00240717 predicted 227
13 SASI_Hs01_00240718 predicted 276
14 SASI_Hs01_00240719 predicted 245
15 SASI_Hs01_00240720 predicted 253
16 SASI_Hs01_00240721 predicted 232
17 SASI_Hs01_00240724 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153388 predicted 340
2 SASI_Mm02_00327161 predicted 580
3 SASI_Mm01_00153390 predicted 265
4 SASI_Mm01_00153391 predicted 419
5 SASI_Mm01_00153392 predicted 581
6 SASI_Mm01_00153393 predicted 646
7 SASI_Mm02_00327162 predicted 654
8 SASI_Mm01_00153394 predicted 617
9 SASI_Mm01_00153395 predicted 644
10 SASI_Mm01_00153396 predicted 564
11 SASI_Mm01_00153389 predicted 241
12 SASI_Mm01_00153397 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023516
VALIDATED
HILPDA MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible lipid droplet-associated
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-654s1c1
Sequence:CCGGCCTAAGTATCTTCTGTTGGTTCTCGAGAACCAACAGAAGATACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023516.3-363s1c1
Sequence:CCGGCCAGACCATCCATCCCGAGGACTCGAGTCCTCGGGATGGATGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-347s1c1
Sequence:CCGGGCCTCCTAAGGGCCTGCCAGACTCGAGTCTGGCAGGCCCTTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-224s1c1
Sequence:CCGGGCTGGGCATCATGTTGACCCTCTCGAGAGGGTCAACATGATGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-245s1c1
Sequence:CCGGGCTTTCCATCTTTGTTAGAGTCTCGAGACTCTAACAAAGATGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-738s21c1
Sequence:CCGGGAAGACAGAGGGTGGACTATCCTCGAGGATAGTCCACCCTCTGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-245s21c1
Sequence:CCGGGCTTTCCATCTTTGTTAGAGTCTCGAGACTCTAACAAAGATGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023516.3-224s21c1
Sequence:CCGGGCTGGGCATCATGTTGACCCTCTCGAGAGGGTCAACATGATGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023516.3-347s21c1
Sequence:CCGGGCCTCCTAAGGGCCTGCCAGACTCGAGTCTGGCAGGCCCTTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-427s21c1
Sequence:CCGGGTCCAACCACACGTTCCATTTCTCGAGAAATGGAACGTGTGGTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-202s21c1
Sequence:CCGGAGTTCATGCTGAACCTCTATGCTCGAGCATAGAGGTTCAGCATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023516
VALIDATED
HILPDA MISSION shRNA shRNA Plasmid DNA
hypoxia inducible lipid droplet-associated
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-654s1c1
Sequence:CCGGCCTAAGTATCTTCTGTTGGTTCTCGAGAACCAACAGAAGATACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023516.3-363s1c1
Sequence:CCGGCCAGACCATCCATCCCGAGGACTCGAGTCCTCGGGATGGATGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-347s1c1
Sequence:CCGGGCCTCCTAAGGGCCTGCCAGACTCGAGTCTGGCAGGCCCTTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-224s1c1
Sequence:CCGGGCTGGGCATCATGTTGACCCTCTCGAGAGGGTCAACATGATGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-245s1c1
Sequence:CCGGGCTTTCCATCTTTGTTAGAGTCTCGAGACTCTAACAAAGATGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-738s21c1
Sequence:CCGGGAAGACAGAGGGTGGACTATCCTCGAGGATAGTCCACCCTCTGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-245s21c1
Sequence:CCGGGCTTTCCATCTTTGTTAGAGTCTCGAGACTCTAACAAAGATGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023516.3-224s21c1
Sequence:CCGGGCTGGGCATCATGTTGACCCTCTCGAGAGGGTCAACATGATGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023516.3-347s21c1
Sequence:CCGGGCCTCCTAAGGGCCTGCCAGACTCGAGTCTGGCAGGCCCTTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-427s21c1
Sequence:CCGGGTCCAACCACACGTTCCATTTCTCGAGAAATGGAACGTGTGGTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-202s21c1
Sequence:CCGGAGTTCATGCTGAACCTCTATGCTCGAGCATAGAGGTTCAGCATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023516
VALIDATED
HILPDA MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible lipid droplet-associated
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-654s1c1
Sequence:CCGGCCTAAGTATCTTCTGTTGGTTCTCGAGAACCAACAGAAGATACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023516.3-363s1c1
Sequence:CCGGCCAGACCATCCATCCCGAGGACTCGAGTCCTCGGGATGGATGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-347s1c1
Sequence:CCGGGCCTCCTAAGGGCCTGCCAGACTCGAGTCTGGCAGGCCCTTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-224s1c1
Sequence:CCGGGCTGGGCATCATGTTGACCCTCTCGAGAGGGTCAACATGATGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023516.3-245s1c1
Sequence:CCGGGCTTTCCATCTTTGTTAGAGTCTCGAGACTCTAACAAAGATGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-738s21c1
Sequence:CCGGGAAGACAGAGGGTGGACTATCCTCGAGGATAGTCCACCCTCTGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-245s21c1
Sequence:CCGGGCTTTCCATCTTTGTTAGAGTCTCGAGACTCTAACAAAGATGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023516.3-224s21c1
Sequence:CCGGGCTGGGCATCATGTTGACCCTCTCGAGAGGGTCAACATGATGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023516.3-347s21c1
Sequence:CCGGGCCTCCTAAGGGCCTGCCAGACTCGAGTCTGGCAGGCCCTTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-427s21c1
Sequence:CCGGGTCCAACCACACGTTCCATTTCTCGAGAAATGGAACGTGTGGTTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023516.3-202s21c1
Sequence:CCGGAGTTCATGCTGAACCTCTATGCTCGAGCATAGAGGTTCAGCATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013332
VALIDATED
HILPDA MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible lipid droplet-associated
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-249s1c1
Sequence:CCGGCCCTACTCTCCATCTTCGTTACTCGAGTAACGAAGATGGAGAGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-256s1c1
Sequence:CCGGCTCCATCTTCGTTAGAGTGATCTCGAGATCACTCTAACGAAGATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-913s1c1
Sequence:CCGGGATAGGTTGATCTCGCCCTTACTCGAGTAAGGGCGAGATCAACCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-1062s1c1
Sequence:CCGGCCTTTAGTCTTGAATGTCTTACTCGAGTAAGACATTCAAGACTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-488s1c1
Sequence:CCGGCGTTGTAACCAGAGAACTATTCTCGAGAATAGTTCTCTGGTTACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013332.1-487s1c1
Sequence:CCGGCCGTTGTAACCAGAGAACTATCTCGAGATAGTTCTCTGGTTACAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-266s1c1
Sequence:CCGGGTTAGAGTGATGGAGTCCCTACTCGAGTAGGGACTCCATCACTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013332.3-273s21c1
Sequence:CCGGTGTTGAACCTCTACCTGTTAGCTCGAGCTAACAGGTAGAGGTTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-969s21c1
Sequence:CCGGGATAGGTTGATCTCGCCCTTACTCGAGTAAGGGCGAGATCAACCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013332.3-437s21c1
Sequence:CCGGCCATCCAGAAGCATGTGATAACTCGAGTTATCACATGCTTCTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-545s21c1
Sequence:CCGGCGTTGTAACCAGAGAACTATTCTCGAGAATAGTTCTCTGGTTACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-1118s21c1
Sequence:CCGGCCTTTAGTCTTGAATGTCTTACTCGAGTAAGACATTCAAGACTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013332
VALIDATED
HILPDA MISSION shRNA shRNA Plasmid DNA
hypoxia inducible lipid droplet-associated
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-249s1c1
Sequence:CCGGCCCTACTCTCCATCTTCGTTACTCGAGTAACGAAGATGGAGAGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-256s1c1
Sequence:CCGGCTCCATCTTCGTTAGAGTGATCTCGAGATCACTCTAACGAAGATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-913s1c1
Sequence:CCGGGATAGGTTGATCTCGCCCTTACTCGAGTAAGGGCGAGATCAACCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-1062s1c1
Sequence:CCGGCCTTTAGTCTTGAATGTCTTACTCGAGTAAGACATTCAAGACTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-488s1c1
Sequence:CCGGCGTTGTAACCAGAGAACTATTCTCGAGAATAGTTCTCTGGTTACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013332.1-487s1c1
Sequence:CCGGCCGTTGTAACCAGAGAACTATCTCGAGATAGTTCTCTGGTTACAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-266s1c1
Sequence:CCGGGTTAGAGTGATGGAGTCCCTACTCGAGTAGGGACTCCATCACTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013332.3-273s21c1
Sequence:CCGGTGTTGAACCTCTACCTGTTAGCTCGAGCTAACAGGTAGAGGTTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-969s21c1
Sequence:CCGGGATAGGTTGATCTCGCCCTTACTCGAGTAAGGGCGAGATCAACCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013332.3-437s21c1
Sequence:CCGGCCATCCAGAAGCATGTGATAACTCGAGTTATCACATGCTTCTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-545s21c1
Sequence:CCGGCGTTGTAACCAGAGAACTATTCTCGAGAATAGTTCTCTGGTTACAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-1118s21c1
Sequence:CCGGCCTTTAGTCTTGAATGTCTTACTCGAGTAAGACATTCAAGACTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013332
VALIDATED
HILPDA MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible lipid droplet-associated
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-249s1c1
Sequence:CCGGCCCTACTCTCCATCTTCGTTACTCGAGTAACGAAGATGGAGAGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-256s1c1
Sequence:CCGGCTCCATCTTCGTTAGAGTGATCTCGAGATCACTCTAACGAAGATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-913s1c1
Sequence:CCGGGATAGGTTGATCTCGCCCTTACTCGAGTAAGGGCGAGATCAACCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-1062s1c1
Sequence:CCGGCCTTTAGTCTTGAATGTCTTACTCGAGTAAGACATTCAAGACTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013332.1-488s1c1
Sequence:CCGGCGTTGTAACCAGAGAACTATTCTCGAGAATAGTTCTCTGGTTACAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013332.1-487s1c1
Sequence:CCGGCCGTTGTAACCAGAGAACTATCTCGAGATAGTTCTCTGGTTACAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013332.1-266s1c1
Sequence:CCGGGTTAGAGTGATGGAGTCCCTACTCGAGTAGGGACTCCATCACTCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013332.3-273s21c1
Sequence:CCGGTGTTGAACCTCTACCTGTTAGCTCGAGCTAACAGGTAGAGGTTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-969s21c1
Sequence:CCGGGATAGGTTGATCTCGCCCTTACTCGAGTAAGGGCGAGATCAACCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013332.3-437s21c1
Sequence:CCGGCCATCCAGAAGCATGTGATAACTCGAGTTATCACATGCTTCTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-545s21c1
Sequence:CCGGCGTTGTAACCAGAGAACTATTCTCGAGAATAGTTCTCTGGTTACAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013332.3-1118s21c1
Sequence:CCGGCCTTTAGTCTTGAATGTCTTACTCGAGTAAGACATTCAAGACTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)