EMAIL THIS PAGE TO A FRIEND

HILS1

histone linker H1 domain, spermatid-specific 1, pseudogene

64 Gene Product Result for
UniProtKB ID: P60008
Gene ID:
Mouse(54388) histone H1-like protein in spermatids 1
Rat(690026) histone linker H1 domain, spermatid-specific 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194072 Rosetta Predictions human pricing
XR_040471 Rosetta Predictions human pricing
XR_040472 Rosetta Predictions human pricing
XR_040473 Rosetta Predictions human pricing
NM_001109565 Rosetta Predictions rat pricing
NM_018792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132074 predicted 548
2 SASI_Hs01_00132075 predicted 341
3 SASI_Hs01_00132076 predicted 557
4 SASI_Hs01_00132077 predicted 641
5 SASI_Hs01_00132078 predicted 527
6 SASI_Hs01_00132079 predicted 564
7 SASI_Hs01_00132080 predicted 335
8 SASI_Hs01_00132081 predicted 535
9 SASI_Hs01_00132082 predicted 328
10 SASI_Hs01_00132083 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519211 predicted 346
2 SASI_Hs02_00519212 predicted 342
3 SASI_Hs02_00519213 predicted 344
4 SASI_Hs02_00519214 predicted 317
5 SASI_Hs02_00519215 predicted 357
6 SASI_Hs02_00519216 predicted 330
7 SASI_Hs02_00519217 predicted 332
8 SASI_Hs02_00519218 predicted 223
9 SASI_Hs02_00519219 predicted 355
10 SASI_Hs02_00519220 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519221 predicted 337
2 SASI_Hs02_00519222 predicted 342
3 SASI_Hs02_00519223 predicted 340
4 SASI_Hs02_00519224 predicted 311
5 SASI_Hs02_00519225 predicted 357
6 SASI_Hs02_00519226 predicted 331
7 SASI_Hs02_00519227 predicted 332
8 SASI_Hs02_00519228 predicted 220
9 SASI_Hs02_00519229 predicted 351
10 SASI_Hs02_00519230 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519231 predicted 338
2 SASI_Hs02_00519232 predicted 343
3 SASI_Hs02_00519233 predicted 345
4 SASI_Hs02_00519234 predicted 316
5 SASI_Hs02_00519235 predicted 359
6 SASI_Hs02_00519236 predicted 329
7 SASI_Hs02_00519237 predicted 326
8 SASI_Hs02_00519238 predicted 223
9 SASI_Hs02_00519239 predicted 213
10 SASI_Hs02_00519240 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249641 predicted 469
2 SASI_Rn02_00249642 predicted 430
3 SASI_Rn02_00249643 predicted 292
4 SASI_Rn02_00249644 predicted 556
5 SASI_Rn02_00249645 predicted 480
6 SASI_Rn02_00249646 predicted 229
7 SASI_Rn02_00249647 predicted 435
8 SASI_Rn02_00249648 predicted 435
9 SASI_Rn02_00249649 predicted 444
10 SASI_Rn02_00249650 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059676 predicted 278
2 SASI_Mm01_00059677 predicted 279
3 SASI_Mm01_00059678 predicted 329
4 SASI_Mm01_00059679 predicted 357
5 SASI_Mm01_00059680 predicted 428
6 SASI_Mm01_00059681 predicted 407
7 SASI_Mm01_00059682 predicted 419
8 SASI_Mm01_00059683 predicted 377
9 SASI_Mm01_00059684 predicted 469
10 SASI_Mm01_00059685 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194072
HILS1 MISSION shRNA Bacterial Glycerol Stock
histone linker H1 domain, spermatid-specific 1, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-336s1c1
Sequence:CCGGTCAGTGCTGTTGAACTCAAATCTCGAGATTTGAGTTCAACAGCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-565s1c1
Sequence:CCGGTCACTTCAAGCGTGTGCTCAACTCGAGTTGAGCACACGCTTGAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-421s1c1
Sequence:CCGGCTGTGCCAAACCCTGCCAGAACTCGAGTTCTGGCAGGGTTTGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-329s1c1
Sequence:CCGGGTCTCCATCAGTGCTGTTGAACTCGAGTTCAACAGCACTGATGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-204s1c1
Sequence:CCGGCCACAGAGATAACCTCACCAACTCGAGTTGGTGAGGTTATCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194072
HILS1 MISSION shRNA shRNA Plasmid DNA
histone linker H1 domain, spermatid-specific 1, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-336s1c1
Sequence:CCGGTCAGTGCTGTTGAACTCAAATCTCGAGATTTGAGTTCAACAGCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-565s1c1
Sequence:CCGGTCACTTCAAGCGTGTGCTCAACTCGAGTTGAGCACACGCTTGAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-421s1c1
Sequence:CCGGCTGTGCCAAACCCTGCCAGAACTCGAGTTCTGGCAGGGTTTGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-329s1c1
Sequence:CCGGGTCTCCATCAGTGCTGTTGAACTCGAGTTCAACAGCACTGATGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-204s1c1
Sequence:CCGGCCACAGAGATAACCTCACCAACTCGAGTTGGTGAGGTTATCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194072
HILS1 MISSION shRNA Lentiviral Transduction Particles
histone linker H1 domain, spermatid-specific 1, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-336s1c1
Sequence:CCGGTCAGTGCTGTTGAACTCAAATCTCGAGATTTGAGTTCAACAGCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-565s1c1
Sequence:CCGGTCACTTCAAGCGTGTGCTCAACTCGAGTTGAGCACACGCTTGAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-421s1c1
Sequence:CCGGCTGTGCCAAACCCTGCCAGAACTCGAGTTCTGGCAGGGTTTGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-329s1c1
Sequence:CCGGGTCTCCATCAGTGCTGTTGAACTCGAGTTCAACAGCACTGATGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194072.1-204s1c1
Sequence:CCGGCCACAGAGATAACCTCACCAACTCGAGTTGGTGAGGTTATCTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018792
HILS1 MISSION shRNA Bacterial Glycerol Stock
histone linker H1 domain, spermatid-specific 1, pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-420s1c1
Sequence:CCGGCAGGGTACAATATGACCCATACTCGAGTATGGGTCATATTGTACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-326s1c1
Sequence:CCGGCCCACCATGTCGTATGTGATTCTCGAGAATCACATACGACATGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-461s1c1
Sequence:CCGGGTGCTCCAGAATCTACTCGATCTCGAGATCGAGTAGATTCTGGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-463s1c1
Sequence:CCGGGCTCCAGAATCTACTCGATAACTCGAGTTATCGAGTAGATTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-419s1c1
Sequence:CCGGACAGGGTACAATATGACCCATCTCGAGATGGGTCATATTGTACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018792
HILS1 MISSION shRNA shRNA Plasmid DNA
histone linker H1 domain, spermatid-specific 1, pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-420s1c1
Sequence:CCGGCAGGGTACAATATGACCCATACTCGAGTATGGGTCATATTGTACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-326s1c1
Sequence:CCGGCCCACCATGTCGTATGTGATTCTCGAGAATCACATACGACATGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-461s1c1
Sequence:CCGGGTGCTCCAGAATCTACTCGATCTCGAGATCGAGTAGATTCTGGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-463s1c1
Sequence:CCGGGCTCCAGAATCTACTCGATAACTCGAGTTATCGAGTAGATTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-419s1c1
Sequence:CCGGACAGGGTACAATATGACCCATCTCGAGATGGGTCATATTGTACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018792
HILS1 MISSION shRNA Lentiviral Transduction Particles
histone linker H1 domain, spermatid-specific 1, pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-420s1c1
Sequence:CCGGCAGGGTACAATATGACCCATACTCGAGTATGGGTCATATTGTACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-326s1c1
Sequence:CCGGCCCACCATGTCGTATGTGATTCTCGAGAATCACATACGACATGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-461s1c1
Sequence:CCGGGTGCTCCAGAATCTACTCGATCTCGAGATCGAGTAGATTCTGGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-463s1c1
Sequence:CCGGGCTCCAGAATCTACTCGATAACTCGAGTTATCGAGTAGATTCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018792.1-419s1c1
Sequence:CCGGACAGGGTACAATATGACCCATCTCGAGATGGGTCATATTGTACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)