EMAIL THIS PAGE TO A FRIEND

HINFP

histone H4 transcription factor

82 Gene Product Result for
Synonyms: HiNF-P MIZF ZNF743
UniProtKB ID: Q9BQA5, B3KPH6, B4DWB4, E9PQF4, Q96E65, Q9Y4M7
Gene ID:
Human(25988) Summary: This gene encodes a transcription factor that interacts with methyl-CpG-binding protein-2 (MBD2), a component of the MeCP1 histone deacetylase (HDAC) complex, and plays a role in DNA methylation and transcription repression. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Aug 2011]
Mouse(102423) histone H4 transcription factor
Rat(300665) histone H4 transcription factor
sheep(101107728) histone H4 transcription factor
domestic guinea pig(100725585) histone H4 transcription factor
naked mole-rat(101705331) histone H4 transcription factor
Zebrafish(406733) histone H4 transcription factor
cow(511965) histone H4 transcription factor
domestic cat(101095609) histone H4 transcription factor
chicken(419756) histone H4 transcription factor
dog(610612) histone H4 transcription factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015517 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015517 Rosetta Predictions human pricing
NM_198971 Rosetta Predictions human pricing
XM_236187 Rosetta Predictions rat pricing
XR_008376 Rosetta Predictions rat pricing
NM_172162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050084 predicted 716
2 SASI_Hs01_00050085 predicted 1173
3 SASI_Hs01_00050086 predicted 722
4 SASI_Hs02_00348012 predicted 1030
5 SASI_Hs01_00050087 predicted 1175
6 SASI_Hs01_00050088 predicted 824
7 SASI_Hs01_00050089 predicted 1331
8 SASI_Hs01_00050090 predicted 730
9 SASI_Hs01_00050092 predicted 930
10 SASI_Hs01_00050093 predicted 940
11 SASI_Hs01_00050091 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063948 predicted 603
2 SASI_Hs01_00063949 predicted 1054
3 SASI_Hs01_00063950 predicted 605
4 SASI_Hs02_00372486 predicted 919
5 SASI_Hs01_00063951 predicted 1059
6 SASI_Hs01_00063952 predicted 706
7 SASI_Hs01_00063953 predicted 1216
8 SASI_Hs01_00063954 predicted 613
9 SASI_Hs01_00063956 predicted 818
10 SASI_Hs01_00063957 predicted 830
11 SASI_Hs01_00063955 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123136 predicted 281
2 SASI_Rn01_00123137 predicted 441
3 SASI_Rn01_00123138 predicted 583
4 SASI_Rn01_00123139 predicted 612
5 SASI_Rn01_00123140 predicted 487
6 SASI_Rn01_00123141 predicted 426
7 SASI_Rn01_00123142 predicted 297
8 SASI_Rn01_00123143 predicted 284
9 SASI_Rn01_00123144 predicted 434
10 SASI_Rn01_00123145 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00416876 predicted 1006
2 SASI_Rn02_00416877 predicted 844
3 SASI_Rn02_00416878 predicted 1020
4 SASI_Rn02_00416879 predicted 922
5 SASI_Rn02_00416880 predicted 933
6 SASI_Rn02_00416881 predicted 1039
7 SASI_Rn01_00149364 predicted 817
8 SASI_Rn02_00416882 predicted 281
9 SASI_Rn02_00416883 predicted 904
10 SASI_Rn02_00416884 predicted 932
11 SASI_Rn01_00149360 predicted 723
12 SASI_Rn01_00149361 predicted 684
13 SASI_Rn01_00149362 predicted 552
14 SASI_Rn01_00149363 predicted 285
15 SASI_Rn01_00149365 predicted 419
16 SASI_Rn01_00149366 predicted 454
17 SASI_Rn01_00149367 predicted 589
18 SASI_Rn01_00149368 predicted 277
19 SASI_Rn01_00149369 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343715 predicted 551
2 SASI_Mm01_00096327 predicted 944
3 SASI_Mm01_00096328 predicted 673
4 SASI_Mm01_00096329 predicted 1285
5 SASI_Mm01_00096330 predicted 753
6 SASI_Mm01_00096331 predicted 642
7 SASI_Mm01_00096332 predicted 770
8 SASI_Mm01_00096333 predicted 872
9 SASI_Mm01_00096334 predicted 952
10 SASI_Mm01_00096335 predicted 963
11 SASI_Mm01_00096336 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172162
VALIDATED
HINFP MISSION shRNA Bacterial Glycerol Stock
histone H4 transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-781s1c1
Sequence:CCGGCGGAACCATGTGAATCACTATCTCGAGATAGTGATTCACATGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-757s21c1
Sequence:CCGGGGAACCATGTGAATCACTATACTCGAGTATAGTGATTCACATGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172162.1-1927s1c1
Sequence:CCGGCCTCACTGTTAGTTACGCATTCTCGAGAATGCGTAACTAACAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-661s1c1
Sequence:CCGGGCCAACAACACCAAGTTCTTACTCGAGTAAGAACTTGGTGTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-1168s1c1
Sequence:CCGGCGCTTTCGGTACAAGGAACATCTCGAGATGTTCCTTGTACCGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-1465s1c1
Sequence:CCGGCGAGACATTGTCTACTGTGTACTCGAGTACACAGTAGACAATGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-846s21c1
Sequence:CCGGAGTGAGGACCGACCCTATAAACTCGAGTTTATAGGGTCGGTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-418s21c1
Sequence:CCGGGCGAGAGTGTCTTCGACAATCCTCGAGGATTGTCGAAGACACTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-1801s21c1
Sequence:CCGGATGCTAGACAGTAAGTATTTACTCGAGTAAATACTTACTGTCTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-546s21c1
Sequence:CCGGACCTTCAAGGACCGGTGTAAGCTCGAGCTTACACCGGTCCTTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172162
VALIDATED
HINFP MISSION shRNA shRNA Plasmid DNA
histone H4 transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-781s1c1
Sequence:CCGGCGGAACCATGTGAATCACTATCTCGAGATAGTGATTCACATGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-757s21c1
Sequence:CCGGGGAACCATGTGAATCACTATACTCGAGTATAGTGATTCACATGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172162.1-1927s1c1
Sequence:CCGGCCTCACTGTTAGTTACGCATTCTCGAGAATGCGTAACTAACAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-661s1c1
Sequence:CCGGGCCAACAACACCAAGTTCTTACTCGAGTAAGAACTTGGTGTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-1168s1c1
Sequence:CCGGCGCTTTCGGTACAAGGAACATCTCGAGATGTTCCTTGTACCGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-1465s1c1
Sequence:CCGGCGAGACATTGTCTACTGTGTACTCGAGTACACAGTAGACAATGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-846s21c1
Sequence:CCGGAGTGAGGACCGACCCTATAAACTCGAGTTTATAGGGTCGGTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-418s21c1
Sequence:CCGGGCGAGAGTGTCTTCGACAATCCTCGAGGATTGTCGAAGACACTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-1801s21c1
Sequence:CCGGATGCTAGACAGTAAGTATTTACTCGAGTAAATACTTACTGTCTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-546s21c1
Sequence:CCGGACCTTCAAGGACCGGTGTAAGCTCGAGCTTACACCGGTCCTTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172162
VALIDATED
HINFP MISSION shRNA Lentiviral Transduction Particles
histone H4 transcription factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-781s1c1
Sequence:CCGGCGGAACCATGTGAATCACTATCTCGAGATAGTGATTCACATGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-757s21c1
Sequence:CCGGGGAACCATGTGAATCACTATACTCGAGTATAGTGATTCACATGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172162.1-1927s1c1
Sequence:CCGGCCTCACTGTTAGTTACGCATTCTCGAGAATGCGTAACTAACAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-661s1c1
Sequence:CCGGGCCAACAACACCAAGTTCTTACTCGAGTAAGAACTTGGTGTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-1168s1c1
Sequence:CCGGCGCTTTCGGTACAAGGAACATCTCGAGATGTTCCTTGTACCGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172162.1-1465s1c1
Sequence:CCGGCGAGACATTGTCTACTGTGTACTCGAGTACACAGTAGACAATGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-846s21c1
Sequence:CCGGAGTGAGGACCGACCCTATAAACTCGAGTTTATAGGGTCGGTCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-418s21c1
Sequence:CCGGGCGAGAGTGTCTTCGACAATCCTCGAGGATTGTCGAAGACACTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-1801s21c1
Sequence:CCGGATGCTAGACAGTAAGTATTTACTCGAGTAAATACTTACTGTCTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172162.2-546s21c1
Sequence:CCGGACCTTCAAGGACCGGTGTAAGCTCGAGCTTACACCGGTCCTTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015517
HINFP MISSION shRNA Bacterial Glycerol Stock
histone H4 transcription factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1167s1c1
Sequence:CCGGCTGCTCTATCAAGTCCCATTACTCGAGTAATGGGACTTGATAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-934s1c1
Sequence:CCGGCGCAACCATGTGAATCACTATCTCGAGATAGTGATTCACATGGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1624s1c1
Sequence:CCGGGTCTACTATGTGCTGTCTGAACTCGAGTTCAGACAGCACATAGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1327s1c1
Sequence:CCGGCGGTACAAGGAACATGAAGATCTCGAGATCTTCATGTTCCTTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-441s1c1
Sequence:CCGGCCATGTCTACTTCCACTGCTACTCGAGTAGCAGTGGAAGTAGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015517.3-1874s21c1
Sequence:CCGCTGGCCTGGGTTTGCATCATTCCTCGAGGAATGATGCAAACCCAGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015517.3-1059s21c1
Sequence:CCGGCTACAGCTGCAAGAATCTTATCTCGAGATAAGATTCTTGCAGCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015517.3-1208s21c1
Sequence:CCGGACTCTGAGCCAAGGTACAAATCTCGAGATTTGTACCTTGGCTCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015517
HINFP MISSION shRNA shRNA Plasmid DNA
histone H4 transcription factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1167s1c1
Sequence:CCGGCTGCTCTATCAAGTCCCATTACTCGAGTAATGGGACTTGATAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-934s1c1
Sequence:CCGGCGCAACCATGTGAATCACTATCTCGAGATAGTGATTCACATGGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1624s1c1
Sequence:CCGGGTCTACTATGTGCTGTCTGAACTCGAGTTCAGACAGCACATAGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1327s1c1
Sequence:CCGGCGGTACAAGGAACATGAAGATCTCGAGATCTTCATGTTCCTTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-441s1c1
Sequence:CCGGCCATGTCTACTTCCACTGCTACTCGAGTAGCAGTGGAAGTAGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015517.3-1874s21c1
Sequence:CCGCTGGCCTGGGTTTGCATCATTCCTCGAGGAATGATGCAAACCCAGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015517.3-1059s21c1
Sequence:CCGGCTACAGCTGCAAGAATCTTATCTCGAGATAAGATTCTTGCAGCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015517.3-1208s21c1
Sequence:CCGGACTCTGAGCCAAGGTACAAATCTCGAGATTTGTACCTTGGCTCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015517
HINFP MISSION shRNA Lentiviral Transduction Particles
histone H4 transcription factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1167s1c1
Sequence:CCGGCTGCTCTATCAAGTCCCATTACTCGAGTAATGGGACTTGATAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-934s1c1
Sequence:CCGGCGCAACCATGTGAATCACTATCTCGAGATAGTGATTCACATGGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1624s1c1
Sequence:CCGGGTCTACTATGTGCTGTCTGAACTCGAGTTCAGACAGCACATAGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-1327s1c1
Sequence:CCGGCGGTACAAGGAACATGAAGATCTCGAGATCTTCATGTTCCTTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015517.3-441s1c1
Sequence:CCGGCCATGTCTACTTCCACTGCTACTCGAGTAGCAGTGGAAGTAGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015517.3-1874s21c1
Sequence:CCGCTGGCCTGGGTTTGCATCATTCCTCGAGGAATGATGCAAACCCAGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015517.3-1059s21c1
Sequence:CCGGCTACAGCTGCAAGAATCTTATCTCGAGATAAGATTCTTGCAGCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015517.3-1208s21c1
Sequence:CCGGACTCTGAGCCAAGGTACAAATCTCGAGATTTGTACCTTGGCTCAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)