EMAIL THIS PAGE TO A FRIEND

HINT1

histidine triad nucleotide binding protein 1

61 Gene Product Result for
Synonyms: HINT NMAN PKCI-1 PRKCNH1
UniProtKB ID: P49773, Q9H5W8
Gene ID:
Human(3094) Summary: The protein encoded by this gene can hydrolyze substrates such as AMP-morpholidate, AMP-N-alanine methyl ester, AMP-alpha-acetyl lysine methyl ester, and AMP-NH2. The encoded protein interacts with these substrates via a histidine triad motif, which is part of the loop that binds to the substrate. This gene has been found to be a tumor suppressing gene. Several transcript variants, but only one of them protein-coding, have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(15254) histidine triad nucleotide binding protein 1
Rat(690660) histidine triad nucleotide binding protein 1
Zebrafish(449551) histidine triad nucleotide binding protein 1
cow(327693) histidine triad nucleotide binding protein 1
domestic cat(101083139) histidine triad nucleotide binding protein 1
dog(474667) histidine triad nucleotide binding protein 1
chicken(395424) histidine triad nucleotide binding protein 1
naked mole-rat(101700957) histidine triad nucleotide binding protein 1
sheep(101104062) histidine triad nucleotide binding protein 1
Domestic Rabbit(100009302) histidine triad nucleotide binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101041 Anti-HINT1 (ab1) antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, human, rat, horse, mouse, rabbit, canine, bovine, chicken
western blot pricing
SAB2101042 Anti-HINT1 (ab2) antibody produced in rabbit affinity isolated antibody , rat, horse, human, bovine, zebrafish, rabbit, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2108150 Anti-HINT1 antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, human, bovine, canine, guinea pig, horse
immunohistochemistry, western blot pricing
PRS4815 Anti-HINT1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunocytochemistry, western blot pricing
SAB4501393 Anti-HINT1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
HPA044577 Anti-HINT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402220 Monoclonal Anti-HINT1 antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005340 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005340 Rosetta Predictions human pricing
NM_001109607 Rosetta Predictions rat pricing
NM_008248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339412 predicted 456
2 SASI_Hs02_00339413 predicted 318
3 SASI_Hs01_00131809 predicted 455
4 SASI_Hs02_00339414 predicted 555
5 SASI_Hs02_00339415 predicted 317
6 SASI_Hs01_00131814 predicted 303
7 SASI_Hs02_00339416 predicted 710
8 SASI_Hs02_00339417 predicted 568
9 SASI_Hs02_00339418 predicted 560
10 SASI_Hs01_00131810 predicted 404
11 SASI_Hs01_00131811 predicted 424
12 SASI_Hs01_00131812 predicted 391
13 SASI_Hs01_00131813 predicted 459
14 SASI_Hs01_00131815 predicted 251
15 SASI_Hs01_00131816 predicted 411
16 SASI_Hs01_00131817 predicted 354
17 SASI_Hs01_00131818 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250037 predicted 327
2 SASI_Rn02_00250038 predicted 219
3 SASI_Rn02_00250039 predicted 292
4 SASI_Rn02_00250040 predicted 327
5 SASI_Rn02_00250041 predicted 327
6 SASI_Rn02_00250042 predicted 232
7 SASI_Rn02_00250043 predicted 304
8 SASI_Rn02_00250044 predicted 233
9 SASI_Rn02_00250045 predicted 226
10 SASI_Rn02_00250046 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048023 predicted 325
2 SASI_Mm01_00048024 predicted 222
3 SASI_Mm01_00048025 predicted 329
4 SASI_Mm01_00048026 predicted 318
5 SASI_Mm01_00048027 predicted 227
6 SASI_Mm01_00048028 predicted 233
7 SASI_Mm01_00048029 predicted 232
8 SASI_Mm01_00048030 predicted 323
9 SASI_Mm01_00048031 predicted 209
10 SASI_Mm01_00048032 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005340
VALIDATED
HINT1 MISSION shRNA Bacterial Glycerol Stock
histidine triad nucleotide binding protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005340.5-250s21c1
Sequence:GTACCGGCCTTGCTTTCCATGACATTTCCTCGAGGAAATGTCATGGAAAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-181s21c1
Sequence:CCGGCGACACGATCTTTGGGAAGATCTCGAGATCTTCCCAAAGATCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-553s21c1
Sequence:CCGGATGATTAAGTTAGGCAATTTCCTCGAGGAAATTGCCTAACTTAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-402s21c1
Sequence:CCGGGCCTGAATAAGGGTTATCGAACTCGAGTTCGATAACCCTTATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-296s21c1
Sequence:CCGGGTGATACCCAAGAAACATATACTCGAGTATATGTTTCTTGGGTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-478s21c1
Sequence:CCGGTGTTCTTGGAGGTCGGCAAATCTCGAGATTTGCCGACCTCCAAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-140s1c1
Sequence:CCGGCGACACGATCTTTGGGAAGATCTCGAGATCTTCCCAAAGATCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005340.2-149s1c1
Sequence:CCGGCTTTGGGAAGATCATCCGCAACTCGAGTTGCGGATGATCTTCCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-255s1c1
Sequence:CCGGGTGATACCCAAGAAACATATACTCGAGTATATGTTTCTTGGGTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-361s1c1
Sequence:CCGGGCCTGAATAAGGGTTATCGAACTCGAGTTCGATAACCCTTATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-165s1c1
Sequence:CCGGCGCAAGGAAATACCAGCCAAACTCGAGTTTGGCTGGTATTTCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005340
VALIDATED
HINT1 MISSION shRNA shRNA Plasmid DNA
histidine triad nucleotide binding protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005340.5-250s21c1
Sequence:GTACCGGCCTTGCTTTCCATGACATTTCCTCGAGGAAATGTCATGGAAAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-181s21c1
Sequence:CCGGCGACACGATCTTTGGGAAGATCTCGAGATCTTCCCAAAGATCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-553s21c1
Sequence:CCGGATGATTAAGTTAGGCAATTTCCTCGAGGAAATTGCCTAACTTAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-402s21c1
Sequence:CCGGGCCTGAATAAGGGTTATCGAACTCGAGTTCGATAACCCTTATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-296s21c1
Sequence:CCGGGTGATACCCAAGAAACATATACTCGAGTATATGTTTCTTGGGTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-478s21c1
Sequence:CCGGTGTTCTTGGAGGTCGGCAAATCTCGAGATTTGCCGACCTCCAAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-140s1c1
Sequence:CCGGCGACACGATCTTTGGGAAGATCTCGAGATCTTCCCAAAGATCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005340.2-149s1c1
Sequence:CCGGCTTTGGGAAGATCATCCGCAACTCGAGTTGCGGATGATCTTCCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-255s1c1
Sequence:CCGGGTGATACCCAAGAAACATATACTCGAGTATATGTTTCTTGGGTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-361s1c1
Sequence:CCGGGCCTGAATAAGGGTTATCGAACTCGAGTTCGATAACCCTTATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-165s1c1
Sequence:CCGGCGCAAGGAAATACCAGCCAAACTCGAGTTTGGCTGGTATTTCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005340
VALIDATED
HINT1 MISSION shRNA Lentiviral Transduction Particles
histidine triad nucleotide binding protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005340.5-250s21c1
Sequence:GTACCGGCCTTGCTTTCCATGACATTTCCTCGAGGAAATGTCATGGAAAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-181s21c1
Sequence:CCGGCGACACGATCTTTGGGAAGATCTCGAGATCTTCCCAAAGATCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-553s21c1
Sequence:CCGGATGATTAAGTTAGGCAATTTCCTCGAGGAAATTGCCTAACTTAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-402s21c1
Sequence:CCGGGCCTGAATAAGGGTTATCGAACTCGAGTTCGATAACCCTTATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-296s21c1
Sequence:CCGGGTGATACCCAAGAAACATATACTCGAGTATATGTTTCTTGGGTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005340.5-478s21c1
Sequence:CCGGTGTTCTTGGAGGTCGGCAAATCTCGAGATTTGCCGACCTCCAAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-140s1c1
Sequence:CCGGCGACACGATCTTTGGGAAGATCTCGAGATCTTCCCAAAGATCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005340.2-149s1c1
Sequence:CCGGCTTTGGGAAGATCATCCGCAACTCGAGTTGCGGATGATCTTCCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-255s1c1
Sequence:CCGGGTGATACCCAAGAAACATATACTCGAGTATATGTTTCTTGGGTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-361s1c1
Sequence:CCGGGCCTGAATAAGGGTTATCGAACTCGAGTTCGATAACCCTTATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005340.2-165s1c1
Sequence:CCGGCGCAAGGAAATACCAGCCAAACTCGAGTTTGGCTGGTATTTCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008248
VALIDATED
HINT1 MISSION shRNA Bacterial Glycerol Stock
histidine triad nucleotide binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-111s21c1
Sequence:CCGGGCAAGATCATCCGCAAAGAAACTCGAGTTTCTTTGCGGATGATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-205s21c1
Sequence:CCGGCTTTCTGGTGATACCCAAGAACTCGAGTTCTTGGGTATCACCAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-97s21c1
Sequence:CCGGCGACACGATCTTCGGCAAGATCTCGAGATCTTGCCGAAGATCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-235s21c1
Sequence:CCGGCCAGATTTCTGTAGCAGATGACTCGAGTCATCTGCTACAGAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-260s21c1
Sequence:CCGGGATGAAAGTCTTCTAGGACATCTCGAGATGTCCTAGAAGACTTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-97s1c1
Sequence:CCGGCGACACGATCTTCGGCAAGATCTCGAGATCTTGCCGAAGATCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-235s1c1
Sequence:CCGGCCAGATTTCTGTAGCAGATGACTCGAGTCATCTGCTACAGAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-111s1c1
Sequence:CCGGGCAAGATCATCCGCAAAGAAACTCGAGTTTCTTTGCGGATGATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-205s1c1
Sequence:CCGGCTTTCTGGTGATACCCAAGAACTCGAGTTCTTGGGTATCACCAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008248.1-260s1c1
Sequence:CCGGGATGAAAGTCTTCTAGGACATCTCGAGATGTCCTAGAAGACTTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008248
VALIDATED
HINT1 MISSION shRNA shRNA Plasmid DNA
histidine triad nucleotide binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-111s21c1
Sequence:CCGGGCAAGATCATCCGCAAAGAAACTCGAGTTTCTTTGCGGATGATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-205s21c1
Sequence:CCGGCTTTCTGGTGATACCCAAGAACTCGAGTTCTTGGGTATCACCAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-97s21c1
Sequence:CCGGCGACACGATCTTCGGCAAGATCTCGAGATCTTGCCGAAGATCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-235s21c1
Sequence:CCGGCCAGATTTCTGTAGCAGATGACTCGAGTCATCTGCTACAGAAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-260s21c1
Sequence:CCGGGATGAAAGTCTTCTAGGACATCTCGAGATGTCCTAGAAGACTTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-97s1c1
Sequence:CCGGCGACACGATCTTCGGCAAGATCTCGAGATCTTGCCGAAGATCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-235s1c1
Sequence:CCGGCCAGATTTCTGTAGCAGATGACTCGAGTCATCTGCTACAGAAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-111s1c1
Sequence:CCGGGCAAGATCATCCGCAAAGAAACTCGAGTTTCTTTGCGGATGATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-205s1c1
Sequence:CCGGCTTTCTGGTGATACCCAAGAACTCGAGTTCTTGGGTATCACCAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008248.1-260s1c1
Sequence:CCGGGATGAAAGTCTTCTAGGACATCTCGAGATGTCCTAGAAGACTTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008248
VALIDATED
HINT1 MISSION shRNA Lentiviral Transduction Particles
histidine triad nucleotide binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-111s21c1
Sequence:CCGGGCAAGATCATCCGCAAAGAAACTCGAGTTTCTTTGCGGATGATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-205s21c1
Sequence:CCGGCTTTCTGGTGATACCCAAGAACTCGAGTTCTTGGGTATCACCAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-97s21c1
Sequence:CCGGCGACACGATCTTCGGCAAGATCTCGAGATCTTGCCGAAGATCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-235s21c1
Sequence:CCGGCCAGATTTCTGTAGCAGATGACTCGAGTCATCTGCTACAGAAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008248.2-260s21c1
Sequence:CCGGGATGAAAGTCTTCTAGGACATCTCGAGATGTCCTAGAAGACTTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-97s1c1
Sequence:CCGGCGACACGATCTTCGGCAAGATCTCGAGATCTTGCCGAAGATCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-235s1c1
Sequence:CCGGCCAGATTTCTGTAGCAGATGACTCGAGTCATCTGCTACAGAAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-111s1c1
Sequence:CCGGGCAAGATCATCCGCAAAGAAACTCGAGTTTCTTTGCGGATGATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008248.1-205s1c1
Sequence:CCGGCTTTCTGGTGATACCCAAGAACTCGAGTTCTTGGGTATCACCAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008248.1-260s1c1
Sequence:CCGGGATGAAAGTCTTCTAGGACATCTCGAGATGTCCTAGAAGACTTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)