EMAIL THIS PAGE TO A FRIEND

HINT3

histidine triad nucleotide binding protein 3

83 Gene Product Result for
Synonyms: HINT4
UniProtKB ID: Q9NQE9, B3KQ91, Q8N0Y9
Gene ID:
Human(135114) Summary: Histidine triad proteins, such as HINT3, are nucleotide hydrolases and transferases that act on the alpha-phosphate of ribonucleotides (Brenner, 2002 [PubMed 12119013]
Mouse(66847) histidine triad nucleotide binding protein 3
Rat(246769) histidine triad nucleotide binding protein 3
sheep(101122605) histidine triad nucleotide binding protein 3
domestic guinea pig(100728104) histidine triad nucleotide binding protein 3
naked mole-rat(101718195) histidine triad nucleotide binding protein 3
Zebrafish(796590) histidine triad nucleotide binding protein 3
Thale Cress(2746201) protein histidine triad nucleotide-binding 3
cow(281817) histidine triad nucleotide binding protein 3
domestic cat(101084364) histidine triad nucleotide binding protein 3
dog(476284) histidine triad nucleotide binding protein 3
chicken(769579) histidine triad nucleotide binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138571 Rosetta Predictions human pricing
XM_001055319 Rosetta Predictions rat pricing
XM_001055373 Rosetta Predictions rat pricing
XM_341742 Rosetta Predictions rat pricing
NM_025798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169346 predicted 933
2 SASI_Hs01_00169347 predicted 837
3 SASI_Hs01_00169348 predicted 847
4 SASI_Hs01_00169349 predicted 470
5 SASI_Hs01_00169350 predicted 448
6 SASI_Hs02_00363714 predicted 839
7 SASI_Hs01_00169351 predicted 675
8 SASI_Hs01_00169352 predicted 560
9 SASI_Hs02_00363715 predicted 662
10 SASI_Hs02_00363716 predicted 646
11 SASI_Hs01_00169343 predicted 930
12 SASI_Hs01_00169344 predicted 548
13 SASI_Hs01_00169345 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279177 predicted 270
2 SASI_Rn02_00279178 predicted 338
3 SASI_Rn02_00279179 predicted 305
4 SASI_Rn02_00279180 predicted 351
5 SASI_Rn02_00279181 predicted 239
6 SASI_Rn02_00279182 predicted 320
7 SASI_Rn02_00279183 predicted 349
8 SASI_Rn02_00279184 predicted 331
9 SASI_Rn02_00279185 predicted 367
10 SASI_Rn02_00279186 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279304 predicted 272
2 SASI_Rn02_00279305 predicted 336
3 SASI_Rn02_00279306 predicted 463
4 SASI_Rn02_00279307 predicted 575
5 SASI_Rn02_00279308 predicted 446
6 SASI_Rn02_00279309 predicted 563
7 SASI_Rn02_00279310 predicted 673
8 SASI_Rn02_00279311 predicted 303
9 SASI_Rn02_00279312 predicted 437
10 SASI_Rn02_00279313 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175049 predicted 631
2 SASI_Rn01_00175050 predicted 729
3 SASI_Rn02_00393293 predicted 725
4 SASI_Rn01_00175052 predicted 720
5 SASI_Rn02_00393294 predicted 733
6 SASI_Rn02_00393295 predicted 728
7 SASI_Rn02_00393296 predicted 629
8 SASI_Rn02_00393297 predicted 634
9 SASI_Rn02_00393298 predicted 627
10 SASI_Rn02_00393299 predicted 689
11 SASI_Rn01_00175045 predicted 332
12 SASI_Rn01_00175046 predicted 399
13 SASI_Rn01_00175047 predicted 604
14 SASI_Rn01_00175048 predicted 519
15 SASI_Rn01_00175051 predicted 349
16 SASI_Rn01_00175053 predicted 594
17 SASI_Rn01_00175054 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153199 predicted 451
2 SASI_Mm01_00153200 predicted 422
3 SASI_Mm01_00153201 predicted 472
4 SASI_Mm02_00329045 predicted 418
5 SASI_Mm01_00153203 predicted 196
6 SASI_Mm01_00153204 predicted 406
7 SASI_Mm02_00329046 predicted 367
8 SASI_Mm01_00153205 predicted 338
9 SASI_Mm01_00153206 predicted 253
10 SASI_Mm01_00153208 predicted 237
11 SASI_Mm01_00153202 predicted 225
12 SASI_Mm01_00153207 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025798
VALIDATED
HINT3 MISSION shRNA Bacterial Glycerol Stock
histidine triad nucleotide binding protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-430s21c1
Sequence:CCGGGCTTCTTATCAAAGCTGGTTTCTCGAGAAACCAGCTTTGATAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-478s21c1
Sequence:CCGGCAGTTGATTACTTGCTTGAAACTCGAGTTTCAAGCAAGTAATCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-470s21c1
Sequence:CCGGGTTTGTCACAGTTGATTACTTCTCGAGAAGTAATCAACTGTGACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-228s21c1
Sequence:CCGGCCAAAGAAGCATATTGGAAGTCTCGAGACTTCCAATATGCTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-229s1c1
Sequence:CCGGCCAAAGAAGCATATTGGAAGTCTCGAGACTTCCAATATGCTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-471s1c1
Sequence:CCGGGTTTGTCACAGTTGATTACTTCTCGAGAAGTAATCAACTGTGACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025798.2-431s1c1
Sequence:CCGGGCTTCTTATCAAAGCTGGTTTCTCGAGAAACCAGCTTTGATAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-479s1c1
Sequence:CCGGCAGTTGATTACTTGCTTGAAACTCGAGTTTCAAGCAAGTAATCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025798.2-544s1c1
Sequence:CCGGGATTCAGAAGAACTGTTGGTTCTCGAGAACCAACAGTTCTTCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025798
VALIDATED
HINT3 MISSION shRNA shRNA Plasmid DNA
histidine triad nucleotide binding protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-430s21c1
Sequence:CCGGGCTTCTTATCAAAGCTGGTTTCTCGAGAAACCAGCTTTGATAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-478s21c1
Sequence:CCGGCAGTTGATTACTTGCTTGAAACTCGAGTTTCAAGCAAGTAATCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-470s21c1
Sequence:CCGGGTTTGTCACAGTTGATTACTTCTCGAGAAGTAATCAACTGTGACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-228s21c1
Sequence:CCGGCCAAAGAAGCATATTGGAAGTCTCGAGACTTCCAATATGCTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-229s1c1
Sequence:CCGGCCAAAGAAGCATATTGGAAGTCTCGAGACTTCCAATATGCTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-471s1c1
Sequence:CCGGGTTTGTCACAGTTGATTACTTCTCGAGAAGTAATCAACTGTGACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025798.2-431s1c1
Sequence:CCGGGCTTCTTATCAAAGCTGGTTTCTCGAGAAACCAGCTTTGATAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-479s1c1
Sequence:CCGGCAGTTGATTACTTGCTTGAAACTCGAGTTTCAAGCAAGTAATCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025798.2-544s1c1
Sequence:CCGGGATTCAGAAGAACTGTTGGTTCTCGAGAACCAACAGTTCTTCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025798
VALIDATED
HINT3 MISSION shRNA Lentiviral Transduction Particles
histidine triad nucleotide binding protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-430s21c1
Sequence:CCGGGCTTCTTATCAAAGCTGGTTTCTCGAGAAACCAGCTTTGATAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-478s21c1
Sequence:CCGGCAGTTGATTACTTGCTTGAAACTCGAGTTTCAAGCAAGTAATCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-470s21c1
Sequence:CCGGGTTTGTCACAGTTGATTACTTCTCGAGAAGTAATCAACTGTGACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025798.3-228s21c1
Sequence:CCGGCCAAAGAAGCATATTGGAAGTCTCGAGACTTCCAATATGCTTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-229s1c1
Sequence:CCGGCCAAAGAAGCATATTGGAAGTCTCGAGACTTCCAATATGCTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-471s1c1
Sequence:CCGGGTTTGTCACAGTTGATTACTTCTCGAGAAGTAATCAACTGTGACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025798.2-431s1c1
Sequence:CCGGGCTTCTTATCAAAGCTGGTTTCTCGAGAAACCAGCTTTGATAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025798.2-479s1c1
Sequence:CCGGCAGTTGATTACTTGCTTGAAACTCGAGTTTCAAGCAAGTAATCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025798.2-544s1c1
Sequence:CCGGGATTCAGAAGAACTGTTGGTTCTCGAGAACCAACAGTTCTTCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138571
VALIDATED
HINT3 MISSION shRNA Bacterial Glycerol Stock
histidine triad nucleotide binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-460s21c1
Sequence:CCGGGCGAGAATGAGGACCTAATTTCTCGAGAAATTAGGTCCTCATTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-523s21c1
Sequence:CCGGTGGTGCCAAAGAAGCATATTGCTCGAGCAATATGCTTCTTTGGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138571.4-2288s21c1
Sequence:GTACCGGGAGTTCTGCTTCCACTATTATCTCGAGATAATAGTGGAAGCAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-754s21c1
Sequence:CCGGGAGTCAATTCCTATTGGTTTACTCGAGTAAACCAATAGGAATTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-497s21c1
Sequence:CCGGACCAGCAGCAACTCATCATTACTCGAGTAATGATGAGTTGCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-845s1c1
Sequence:CCGGGCTGTTACTTAGTGGCCTTAACTCGAGTTAAGGCCACTAAGTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-650s1c1
Sequence:CCGGGCTTGGCTTCTTATCCAAGTTCTCGAGAACTTGGATAAGAAGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_138571.3-247s1c1
Sequence:CCGGCGACTGCAGAAACTACGGTTTCTCGAGAAACCGTAGTTTCTGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-423s1c1
Sequence:CCGGCCAGCAGCAACTCATCATTATCTCGAGATAATGATGAGTTGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-507s1c1
Sequence:CCGGGTTGAGAACATGGTAACTGTTCTCGAGAACAGTTACCATGTTCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138571
VALIDATED
HINT3 MISSION shRNA shRNA Plasmid DNA
histidine triad nucleotide binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-460s21c1
Sequence:CCGGGCGAGAATGAGGACCTAATTTCTCGAGAAATTAGGTCCTCATTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-523s21c1
Sequence:CCGGTGGTGCCAAAGAAGCATATTGCTCGAGCAATATGCTTCTTTGGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138571.4-2288s21c1
Sequence:GTACCGGGAGTTCTGCTTCCACTATTATCTCGAGATAATAGTGGAAGCAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-754s21c1
Sequence:CCGGGAGTCAATTCCTATTGGTTTACTCGAGTAAACCAATAGGAATTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-497s21c1
Sequence:CCGGACCAGCAGCAACTCATCATTACTCGAGTAATGATGAGTTGCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-845s1c1
Sequence:CCGGGCTGTTACTTAGTGGCCTTAACTCGAGTTAAGGCCACTAAGTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-650s1c1
Sequence:CCGGGCTTGGCTTCTTATCCAAGTTCTCGAGAACTTGGATAAGAAGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_138571.3-247s1c1
Sequence:CCGGCGACTGCAGAAACTACGGTTTCTCGAGAAACCGTAGTTTCTGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-423s1c1
Sequence:CCGGCCAGCAGCAACTCATCATTATCTCGAGATAATGATGAGTTGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-507s1c1
Sequence:CCGGGTTGAGAACATGGTAACTGTTCTCGAGAACAGTTACCATGTTCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138571
VALIDATED
HINT3 MISSION shRNA Lentiviral Transduction Particles
histidine triad nucleotide binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-460s21c1
Sequence:CCGGGCGAGAATGAGGACCTAATTTCTCGAGAAATTAGGTCCTCATTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-523s21c1
Sequence:CCGGTGGTGCCAAAGAAGCATATTGCTCGAGCAATATGCTTCTTTGGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138571.4-2288s21c1
Sequence:GTACCGGGAGTTCTGCTTCCACTATTATCTCGAGATAATAGTGGAAGCAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-754s21c1
Sequence:CCGGGAGTCAATTCCTATTGGTTTACTCGAGTAAACCAATAGGAATTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138571.4-497s21c1
Sequence:CCGGACCAGCAGCAACTCATCATTACTCGAGTAATGATGAGTTGCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-845s1c1
Sequence:CCGGGCTGTTACTTAGTGGCCTTAACTCGAGTTAAGGCCACTAAGTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-650s1c1
Sequence:CCGGGCTTGGCTTCTTATCCAAGTTCTCGAGAACTTGGATAAGAAGCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_138571.3-247s1c1
Sequence:CCGGCGACTGCAGAAACTACGGTTTCTCGAGAAACCGTAGTTTCTGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-423s1c1
Sequence:CCGGCCAGCAGCAACTCATCATTATCTCGAGATAATGATGAGTTGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138571.3-507s1c1
Sequence:CCGGGTTGAGAACATGGTAACTGTTCTCGAGAACAGTTACCATGTTCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)