EMAIL THIS PAGE TO A FRIEND

HIP1

huntingtin interacting protein 1

136 Gene Product Result for
Synonyms: HIP-I ILWEQ
UniProtKB ID: O00291, B4E3I7, E7ES17, O00328, Q2TB58, Q8TDL4
Gene ID:
Human(3092) Summary: The product of this gene is a membrane-associated protein that colocalizes with huntingtin. This protein has similarities to cytoskeleton proteins and its interaction with huntingtin is thought to play a functional role in the cell filament network. Loss of normal huntingtin-HIP1 interaction in Huntington disease may contribute to a defect in membrane-cytoskeletal integrity in the brain. This gene could help in the understanding of the normal function of huntingtin and also the pathogenesis of Huntington disease. It also has been implicated in the pathogenesis of hematopoietic malignancies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(215114) huntingtin interacting protein 1
Rat(192154) huntingtin interacting protein 1
Zebrafish(793823) huntingtin interacting protein 1
fruit fly(39450) Huntingtin interacting protein 1
cow(505919) huntingtin interacting protein 1
Horse(100061280) huntingtin interacting protein 1
domestic cat(101091918) huntingtin interacting protein 1
dog(489814) huntingtin interacting protein 1
chicken(770683) huntingtin interacting protein 1
Thale Cress(828363) tetratricopeptide repeat protein
sheep(101117042) huntingtin interacting protein 1
Domestic Rabbit(100346836) huntingtin interacting protein 1
domestic guinea pig(100718590) huntingtin interacting protein 1
naked mole-rat(101716682) huntingtin interacting protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005338 Rosetta Predictions human pricing
XM_001061381 Rosetta Predictions rat pricing
XM_001071073 Rosetta Predictions rat pricing
XM_001071106 Rosetta Predictions rat pricing
XM_347168 Rosetta Predictions rat pricing
NM_146001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069632 predicted 2712
2 SASI_Hs01_00069633 predicted 1529
3 SASI_Hs02_00339408 predicted 1707
4 SASI_Hs01_00069634 predicted 1543
5 SASI_Hs01_00069635 predicted 474
6 SASI_Hs01_00069636 predicted 1872
7 SASI_Hs01_00069637 predicted 2642
8 SASI_Hs02_00339409 predicted 2939
9 SASI_Hs01_00069639 predicted 2124
10 SASI_Hs01_00069640 predicted 2485
11 SASI_Hs01_00069638 predicted 834
12 SASI_Hs01_00069641 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299866 predicted 1051
2 SASI_Rn02_00299867 predicted 1695
3 SASI_Rn02_00299868 predicted 636
4 SASI_Rn02_00299869 predicted 2943
5 SASI_Rn02_00299870 predicted 1154
6 SASI_Rn02_00299871 predicted 874
7 SASI_Rn02_00299872 predicted 2199
8 SASI_Rn02_00299873 predicted 610
9 SASI_Rn02_00299874 predicted 2084
10 SASI_Rn02_00299875 predicted 2880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333775 predicted 1044
2 SASI_Rn02_00333776 predicted 1693
3 SASI_Rn02_00333777 predicted 632
4 SASI_Rn02_00333778 predicted 2944
5 SASI_Rn02_00333779 predicted 1151
6 SASI_Rn02_00333780 predicted 870
7 SASI_Rn02_00333781 predicted 2199
8 SASI_Rn02_00333782 predicted 615
9 SASI_Rn02_00333783 predicted 2080
10 SASI_Rn02_00333784 predicted 2871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333885 predicted 1051
2 SASI_Rn02_00333886 predicted 1718
3 SASI_Rn02_00333887 predicted 633
4 SASI_Rn02_00333888 predicted 1610
5 SASI_Rn02_00333889 predicted 2975
6 SASI_Rn02_00333890 predicted 1154
7 SASI_Rn02_00333891 predicted 870
8 SASI_Rn02_00333892 predicted 2228
9 SASI_Rn02_00333893 predicted 613
10 SASI_Rn02_00333894 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399576 predicted 1048
2 SASI_Rn02_00399577 predicted 1718
3 SASI_Rn02_00399578 predicted 633
4 SASI_Rn02_00399579 predicted 1613
5 SASI_Rn02_00399580 predicted 2973
6 SASI_Rn02_00399581 predicted 1157
7 SASI_Rn02_00399582 predicted 874
8 SASI_Rn02_00399583 predicted 2226
9 SASI_Rn02_00399584 predicted 609
10 SASI_Rn02_00399585 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181347 predicted 2639
2 SASI_Mm01_00181348 predicted 1073
3 SASI_Mm01_00181349 predicted 2696
4 SASI_Mm01_00181350 predicted 657
5 SASI_Mm01_00181351 predicted 890
6 SASI_Mm01_00181352 predicted 2893
7 SASI_Mm01_00181353 predicted 3120
8 SASI_Mm01_00181354 predicted 1180
9 SASI_Mm01_00181355 predicted 2903
10 SASI_Mm01_00181356 predicted 1647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146001
HIP1 MISSION shRNA Bacterial Glycerol Stock
huntingtin interacting protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146001.1-4298s1c1
Sequence:CCGGGCTCGGTTTAAGACTCTTTATCTCGAGATAAAGAGTCTTAAACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-1442s1c1
Sequence:CCGGCCAGGCTAATGAACAGAGGTACTCGAGTACCTCTGTTCATTAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-494s1c1
Sequence:CCGGGCTGAGAACAAGGATGGAGTACTCGAGTACTCCATCCTTGTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-2886s1c1
Sequence:CCGGGCCTCAACCATTTCTGGCAAACTCGAGTTTGCCAGAAATGGTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-1443s1c1
Sequence:CCGGCAGGCTAATGAACAGAGGTATCTCGAGATACCTCTGTTCATTAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-582s21c1
Sequence:GTACCGGGGCCGGAGAAAGTGACGTTAACTCGAGTTAACGTCACTTTCTCCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1100s21c1
Sequence:GTACCGGACAAGTTTGATGACGTCTTTGCTCGAGCAAAGACGTCATCAAACTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1461s21c1
Sequence:GTACCGGACAGAGGTATAGCAAGTTAAACTCGAGTTTAACTTGCTATACCTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-905s21c1
Sequence:GTACCGGAGTACTTCAAGCGGCTCATTCCTCGAGGAATGAGCCGCTTGAAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-193s21c1
Sequence:GTACCGGAGCGTCAATAAGGCCATTAATCTCGAGATTAATGGCCTTATTGACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1178s21c1
Sequence:GTACCGGACGAGAAGGACCACTTGATTGCTCGAGCAATCAAGTGGTCCTTCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146001
HIP1 MISSION shRNA shRNA Plasmid DNA
huntingtin interacting protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146001.1-4298s1c1
Sequence:CCGGGCTCGGTTTAAGACTCTTTATCTCGAGATAAAGAGTCTTAAACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-1442s1c1
Sequence:CCGGCCAGGCTAATGAACAGAGGTACTCGAGTACCTCTGTTCATTAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-494s1c1
Sequence:CCGGGCTGAGAACAAGGATGGAGTACTCGAGTACTCCATCCTTGTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-2886s1c1
Sequence:CCGGGCCTCAACCATTTCTGGCAAACTCGAGTTTGCCAGAAATGGTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-1443s1c1
Sequence:CCGGCAGGCTAATGAACAGAGGTATCTCGAGATACCTCTGTTCATTAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-582s21c1
Sequence:GTACCGGGGCCGGAGAAAGTGACGTTAACTCGAGTTAACGTCACTTTCTCCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1100s21c1
Sequence:GTACCGGACAAGTTTGATGACGTCTTTGCTCGAGCAAAGACGTCATCAAACTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1461s21c1
Sequence:GTACCGGACAGAGGTATAGCAAGTTAAACTCGAGTTTAACTTGCTATACCTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-905s21c1
Sequence:GTACCGGAGTACTTCAAGCGGCTCATTCCTCGAGGAATGAGCCGCTTGAAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-193s21c1
Sequence:GTACCGGAGCGTCAATAAGGCCATTAATCTCGAGATTAATGGCCTTATTGACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1178s21c1
Sequence:GTACCGGACGAGAAGGACCACTTGATTGCTCGAGCAATCAAGTGGTCCTTCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146001
HIP1 MISSION shRNA Lentiviral Transduction Particles
huntingtin interacting protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146001.1-4298s1c1
Sequence:CCGGGCTCGGTTTAAGACTCTTTATCTCGAGATAAAGAGTCTTAAACCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-1442s1c1
Sequence:CCGGCCAGGCTAATGAACAGAGGTACTCGAGTACCTCTGTTCATTAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-494s1c1
Sequence:CCGGGCTGAGAACAAGGATGGAGTACTCGAGTACTCCATCCTTGTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-2886s1c1
Sequence:CCGGGCCTCAACCATTTCTGGCAAACTCGAGTTTGCCAGAAATGGTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146001.1-1443s1c1
Sequence:CCGGCAGGCTAATGAACAGAGGTATCTCGAGATACCTCTGTTCATTAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-582s21c1
Sequence:GTACCGGGGCCGGAGAAAGTGACGTTAACTCGAGTTAACGTCACTTTCTCCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1100s21c1
Sequence:GTACCGGACAAGTTTGATGACGTCTTTGCTCGAGCAAAGACGTCATCAAACTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1461s21c1
Sequence:GTACCGGACAGAGGTATAGCAAGTTAAACTCGAGTTTAACTTGCTATACCTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-905s21c1
Sequence:GTACCGGAGTACTTCAAGCGGCTCATTCCTCGAGGAATGAGCCGCTTGAAGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-193s21c1
Sequence:GTACCGGAGCGTCAATAAGGCCATTAATCTCGAGATTAATGGCCTTATTGACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146001.2-1178s21c1
Sequence:GTACCGGACGAGAAGGACCACTTGATTGCTCGAGCAATCAAGTGGTCCTTCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005338
VALIDATED
HIP1 MISSION shRNA Bacterial Glycerol Stock
huntingtin interacting protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005338.4-4539s1c1
Sequence:CCGGGCCTTCAAGAATCAGAAGAAACTCGAGTTTCTTCTGATTCTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-2893s1c1
Sequence:CCGGCCTCAACCATTTCCGGCAAATCTCGAGATTTGCCGGAAATGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-1117s1c1
Sequence:CCGGCCTTCAATTTCAACAGTCAAACTCGAGTTTGACTGTTGAAATTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-632s1c1
Sequence:CCGGCCTCTTCCAAACAGTATTCAACTCGAGTTGAATACTGTTTGGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-2534s1c1
Sequence:CCGGGCAAGCTATTCAGGTGCTCATCTCGAGATGAGCACCTGAATAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005338.4-3469s21c1
Sequence:GTACCGGATCCAGTCCTGCTGACTATTTCTCGAGAAATAGTCAGCAGGACTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-1857s21c1
Sequence:GTACCGGGCCAGCACAGAGGAATCTATGCTCGAGCATAGATTCCTCTGTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-1117s21c1
Sequence:CCGGCCTTCAATTTCAACAGTCAAACTCGAGTTTGACTGTTGAAATTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-4539s21c1
Sequence:CCGGGCCTTCAAGAATCAGAAGAAACTCGAGTTTCTTCTGATTCTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-632s21c1
Sequence:CCGGCCTCTTCCAAACAGTATTCAACTCGAGTTGAATACTGTTTGGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-2893s21c1
Sequence:CCGGCCTCAACCATTTCCGGCAAATCTCGAGATTTGCCGGAAATGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-1427s21c1
Sequence:GTACCGGAGCCAATGAACAGCGATATAGCTCGAGCTATATCGCTGTTCATTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005338
VALIDATED
HIP1 MISSION shRNA shRNA Plasmid DNA
huntingtin interacting protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005338.4-4539s1c1
Sequence:CCGGGCCTTCAAGAATCAGAAGAAACTCGAGTTTCTTCTGATTCTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-2893s1c1
Sequence:CCGGCCTCAACCATTTCCGGCAAATCTCGAGATTTGCCGGAAATGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-1117s1c1
Sequence:CCGGCCTTCAATTTCAACAGTCAAACTCGAGTTTGACTGTTGAAATTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-632s1c1
Sequence:CCGGCCTCTTCCAAACAGTATTCAACTCGAGTTGAATACTGTTTGGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-2534s1c1
Sequence:CCGGGCAAGCTATTCAGGTGCTCATCTCGAGATGAGCACCTGAATAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005338.4-3469s21c1
Sequence:GTACCGGATCCAGTCCTGCTGACTATTTCTCGAGAAATAGTCAGCAGGACTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-1857s21c1
Sequence:GTACCGGGCCAGCACAGAGGAATCTATGCTCGAGCATAGATTCCTCTGTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-1117s21c1
Sequence:CCGGCCTTCAATTTCAACAGTCAAACTCGAGTTTGACTGTTGAAATTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-4539s21c1
Sequence:CCGGGCCTTCAAGAATCAGAAGAAACTCGAGTTTCTTCTGATTCTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-632s21c1
Sequence:CCGGCCTCTTCCAAACAGTATTCAACTCGAGTTGAATACTGTTTGGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-2893s21c1
Sequence:CCGGCCTCAACCATTTCCGGCAAATCTCGAGATTTGCCGGAAATGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-1427s21c1
Sequence:GTACCGGAGCCAATGAACAGCGATATAGCTCGAGCTATATCGCTGTTCATTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005338
VALIDATED
HIP1 MISSION shRNA Lentiviral Transduction Particles
huntingtin interacting protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005338.4-4539s1c1
Sequence:CCGGGCCTTCAAGAATCAGAAGAAACTCGAGTTTCTTCTGATTCTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-2893s1c1
Sequence:CCGGCCTCAACCATTTCCGGCAAATCTCGAGATTTGCCGGAAATGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-1117s1c1
Sequence:CCGGCCTTCAATTTCAACAGTCAAACTCGAGTTTGACTGTTGAAATTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-632s1c1
Sequence:CCGGCCTCTTCCAAACAGTATTCAACTCGAGTTGAATACTGTTTGGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005338.4-2534s1c1
Sequence:CCGGGCAAGCTATTCAGGTGCTCATCTCGAGATGAGCACCTGAATAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005338.4-3469s21c1
Sequence:GTACCGGATCCAGTCCTGCTGACTATTTCTCGAGAAATAGTCAGCAGGACTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-1857s21c1
Sequence:GTACCGGGCCAGCACAGAGGAATCTATGCTCGAGCATAGATTCCTCTGTGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-1117s21c1
Sequence:CCGGCCTTCAATTTCAACAGTCAAACTCGAGTTTGACTGTTGAAATTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-4539s21c1
Sequence:CCGGGCCTTCAAGAATCAGAAGAAACTCGAGTTTCTTCTGATTCTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-632s21c1
Sequence:CCGGCCTCTTCCAAACAGTATTCAACTCGAGTTGAATACTGTTTGGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005338.4-2893s21c1
Sequence:CCGGCCTCAACCATTTCCGGCAAATCTCGAGATTTGCCGGAAATGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005338.4-1427s21c1
Sequence:GTACCGGAGCCAATGAACAGCGATATAGCTCGAGCTATATCGCTGTTCATTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)