EMAIL THIS PAGE TO A FRIEND

HIP1R

huntingtin interacting protein 1 related

63 Gene Product Result for
Synonyms: HIP12 HIP3 ILWEQ
UniProtKB ID: O75146, A6NHQ6, Q9UED9
Gene ID:
Mouse(29816) huntingtin interacting protein 1 related
Rat(81917) huntingtin interacting protein 1 related
Zebrafish(436650) huntingtin interacting protein 1 related
domestic cat(101090723) huntingtin interacting protein 1 related
cow(508291) huntingtin interacting protein 1 related
Horse(100060573) huntingtin interacting protein 1 related
dog(486251) huntingtin interacting protein 1 related
chicken(416836) huntingtin interacting protein 1 related
domestic guinea pig(100735798) huntingtin interacting protein 1 related
naked mole-rat(101714826) huntingtin interacting protein 1 related
sheep(101123327) huntingtin interacting protein 1 related
Domestic Rabbit(100008906) huntingtin interacting protein 1 related
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_290592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290592 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003959 Rosetta Predictions human pricing
NM_001134763 Rosetta Predictions rat pricing
NM_031234 Rosetta Predictions rat pricing
NM_145070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242628 predicted 602
2 SASI_Hs01_00242630 predicted 612
3 SASI_Hs02_00336631 predicted 1390
4 SASI_Hs01_00242631 predicted 211
5 SASI_Hs01_00242632 predicted 1188
6 SASI_Hs01_00242634 predicted 2861
7 SASI_Hs02_00336632 predicted 244
8 SASI_Hs01_00242635 predicted 1000
9 SASI_Hs01_00242636 predicted 751
10 SASI_Hs02_00336633 predicted 1389
11 SASI_Hs01_00242629 predicted 2463
12 SASI_Hs01_00242633 predicted 245
13 SASI_Hs01_00242637 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258444 predicted 221
2 SASI_Rn02_00258445 predicted 432
3 SASI_Rn02_00258446 predicted 2705
4 SASI_Rn02_00258447 predicted 596
5 SASI_Rn02_00258448 predicted 285
6 SASI_Rn02_00258449 predicted 1675
7 SASI_Rn02_00258450 predicted 405
8 SASI_Rn02_00258451 predicted 3136
9 SASI_Rn02_00258452 predicted 2640
10 SASI_Rn02_00258453 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264499 predicted 218
2 SASI_Rn02_00264500 predicted 435
3 SASI_Rn02_00264501 predicted 2695
4 SASI_Rn02_00264502 predicted 595
5 SASI_Rn02_00264503 predicted 287
6 SASI_Rn02_00264504 predicted 1679
7 SASI_Rn02_00264505 predicted 405
8 SASI_Rn02_00264506 predicted 3135
9 SASI_Rn02_00264507 predicted 2637
10 SASI_Rn02_00264508 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192566 predicted 311
2 SASI_Mm01_00192567 predicted 1474
3 SASI_Mm01_00192568 predicted 1733
4 SASI_Mm01_00192569 predicted 1475
5 SASI_Mm01_00192570 predicted 917
6 SASI_Mm01_00192571 predicted 634
7 SASI_Mm01_00192572 predicted 3306
8 SASI_Mm01_00192573 predicted 2557
9 SASI_Mm01_00192574 predicted 375
10 SASI_Mm01_00192575 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003959
HIP1R MISSION shRNA Bacterial Glycerol Stock
huntingtin interacting protein 1 related
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-1063s21c1
Sequence:GTACCGGACCTCTTCGATCAGACGTTTGCTCGAGCAAACGTCTGATCGAAGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2871s21c1
Sequence:GTACCGGTGTTCTCGCACAGTCAATGAGCTCGAGCTCATTGACTGTGCGAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2444s21c1
Sequence:GTACCGGAGATGCTGTGCGGAGGATTGACTCGAGTCAATCCTCCGCACAGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2942s21c1
Sequence:GTACCGGGGACAGAGACACCATGGATTTCTCGAGAAATCCATGGTGTCTCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-1266s21c1
Sequence:GTACCGGCAGAAGGCCCTGGTGGATAATCTCGAGATTATCCACCAGGGCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2740s21c1
Sequence:GTACCGGTGCTTCACACGGGCAAGTATGCTCGAGCATACTTGCCCGTGTGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-256s21c1
Sequence:GTACCGGCCTTCTGGTCCTATGCCATTGCTCGAGCAATGGCATAGGACCAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003959
HIP1R MISSION shRNA shRNA Plasmid DNA
huntingtin interacting protein 1 related
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-1063s21c1
Sequence:GTACCGGACCTCTTCGATCAGACGTTTGCTCGAGCAAACGTCTGATCGAAGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2871s21c1
Sequence:GTACCGGTGTTCTCGCACAGTCAATGAGCTCGAGCTCATTGACTGTGCGAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2444s21c1
Sequence:GTACCGGAGATGCTGTGCGGAGGATTGACTCGAGTCAATCCTCCGCACAGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2942s21c1
Sequence:GTACCGGGGACAGAGACACCATGGATTTCTCGAGAAATCCATGGTGTCTCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-1266s21c1
Sequence:GTACCGGCAGAAGGCCCTGGTGGATAATCTCGAGATTATCCACCAGGGCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2740s21c1
Sequence:GTACCGGTGCTTCACACGGGCAAGTATGCTCGAGCATACTTGCCCGTGTGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-256s21c1
Sequence:GTACCGGCCTTCTGGTCCTATGCCATTGCTCGAGCAATGGCATAGGACCAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003959
HIP1R MISSION shRNA Lentiviral Transduction Particles
huntingtin interacting protein 1 related
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-1063s21c1
Sequence:GTACCGGACCTCTTCGATCAGACGTTTGCTCGAGCAAACGTCTGATCGAAGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2871s21c1
Sequence:GTACCGGTGTTCTCGCACAGTCAATGAGCTCGAGCTCATTGACTGTGCGAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2444s21c1
Sequence:GTACCGGAGATGCTGTGCGGAGGATTGACTCGAGTCAATCCTCCGCACAGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2942s21c1
Sequence:GTACCGGGGACAGAGACACCATGGATTTCTCGAGAAATCCATGGTGTCTCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-1266s21c1
Sequence:GTACCGGCAGAAGGCCCTGGTGGATAATCTCGAGATTATCCACCAGGGCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-2740s21c1
Sequence:GTACCGGTGCTTCACACGGGCAAGTATGCTCGAGCATACTTGCCCGTGTGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003959.1-256s21c1
Sequence:GTACCGGCCTTCTGGTCCTATGCCATTGCTCGAGCAATGGCATAGGACCAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145070
VALIDATED
HIP1R MISSION shRNA Bacterial Glycerol Stock
huntingtin interacting protein 1 related
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.3-656s21c1
Sequence:CCGGAGCTTACCGTGGAGATGTTTGCTCGAGCAAACATCTCCACGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-1066s21c1
Sequence:CCGGGCCTGAGAACCTAATTGAAATCTCGAGATTTCAATTAGGTTCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-2565s21c1
Sequence:CCGGGCGTGAAACTGGAGGTGAATGCTCGAGCATTCACCTCCAGTTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-3307s21c1
Sequence:CCGGCCCAGCTCAACTTGTGAACTACTCGAGTAGTTCACAAGTTGAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-2804s21c1
Sequence:CCGGGTGCTTCACATGGGCAAATACCTCGAGGTATTTGCCCATGTGAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145070.2-3950s1c1
Sequence:CCGGGCCTACCTTGATGAGTAGATTCTCGAGAATCTACTCATCAAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-508s1c1
Sequence:CCGGCCTGGTGAATATCTATACCAACTCGAGTTGGTATAGATATTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-3307s1c1
Sequence:CCGGCCCAGCTCAACTTGTGAACTACTCGAGTAGTTCACAAGTTGAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145070.2-1066s1c1
Sequence:CCGGGCCTGAGAACCTAATTGAAATCTCGAGATTTCAATTAGGTTCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-509s1c1
Sequence:CCGGCTGGTGAATATCTATACCAAACTCGAGTTTGGTATAGATATTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.3-887s21c1
Sequence:CCGGATCGGTTCCACGAGCAGTTTCCTCGAGGAAACTGCTCGTGGAACCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145070.2-3460s21c1
Sequence:CCGGATCTGGATGTGAATCTATTTACTCGAGTAAATAGATTCACATCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145070
VALIDATED
HIP1R MISSION shRNA shRNA Plasmid DNA
huntingtin interacting protein 1 related
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.3-656s21c1
Sequence:CCGGAGCTTACCGTGGAGATGTTTGCTCGAGCAAACATCTCCACGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-1066s21c1
Sequence:CCGGGCCTGAGAACCTAATTGAAATCTCGAGATTTCAATTAGGTTCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-2565s21c1
Sequence:CCGGGCGTGAAACTGGAGGTGAATGCTCGAGCATTCACCTCCAGTTTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-3307s21c1
Sequence:CCGGCCCAGCTCAACTTGTGAACTACTCGAGTAGTTCACAAGTTGAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-2804s21c1
Sequence:CCGGGTGCTTCACATGGGCAAATACCTCGAGGTATTTGCCCATGTGAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145070.2-3950s1c1
Sequence:CCGGGCCTACCTTGATGAGTAGATTCTCGAGAATCTACTCATCAAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-508s1c1
Sequence:CCGGCCTGGTGAATATCTATACCAACTCGAGTTGGTATAGATATTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-3307s1c1
Sequence:CCGGCCCAGCTCAACTTGTGAACTACTCGAGTAGTTCACAAGTTGAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145070.2-1066s1c1
Sequence:CCGGGCCTGAGAACCTAATTGAAATCTCGAGATTTCAATTAGGTTCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-509s1c1
Sequence:CCGGCTGGTGAATATCTATACCAAACTCGAGTTTGGTATAGATATTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.3-887s21c1
Sequence:CCGGATCGGTTCCACGAGCAGTTTCCTCGAGGAAACTGCTCGTGGAACCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145070.2-3460s21c1
Sequence:CCGGATCTGGATGTGAATCTATTTACTCGAGTAAATAGATTCACATCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145070
VALIDATED
HIP1R MISSION shRNA Lentiviral Transduction Particles
huntingtin interacting protein 1 related
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.3-656s21c1
Sequence:CCGGAGCTTACCGTGGAGATGTTTGCTCGAGCAAACATCTCCACGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-1066s21c1
Sequence:CCGGGCCTGAGAACCTAATTGAAATCTCGAGATTTCAATTAGGTTCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-2565s21c1
Sequence:CCGGGCGTGAAACTGGAGGTGAATGCTCGAGCATTCACCTCCAGTTTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-3307s21c1
Sequence:CCGGCCCAGCTCAACTTGTGAACTACTCGAGTAGTTCACAAGTTGAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.2-2804s21c1
Sequence:CCGGGTGCTTCACATGGGCAAATACCTCGAGGTATTTGCCCATGTGAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145070.2-3950s1c1
Sequence:CCGGGCCTACCTTGATGAGTAGATTCTCGAGAATCTACTCATCAAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-508s1c1
Sequence:CCGGCCTGGTGAATATCTATACCAACTCGAGTTGGTATAGATATTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-3307s1c1
Sequence:CCGGCCCAGCTCAACTTGTGAACTACTCGAGTAGTTCACAAGTTGAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145070.2-1066s1c1
Sequence:CCGGGCCTGAGAACCTAATTGAAATCTCGAGATTTCAATTAGGTTCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145070.2-509s1c1
Sequence:CCGGCTGGTGAATATCTATACCAAACTCGAGTTTGGTATAGATATTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145070.3-887s21c1
Sequence:CCGGATCGGTTCCACGAGCAGTTTCCTCGAGGAAACTGCTCGTGGAACCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145070.2-3460s21c1
Sequence:CCGGATCTGGATGTGAATCTATTTACTCGAGTAAATAGATTCACATCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290592
VALIDATED
HIP1R MISSION shRNA Bacterial Glycerol Stock
huntingtin interacting protein 1 related
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-1030s1c1
Sequence:CCGGGCCGGAGAATCTCATTGAGATCTCGAGATCTCAATGAGATTCTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:XM_290592.1-4219s1c1
Sequence:CCGGGCCCGTCAGATTTGAACGAATCTCGAGATTCGTTCAAATCTGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-3178s1c1
Sequence:CCGGCCGAAGTGTAACCACCAAGAACTCGAGTTCTTGGTGGTTACACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_290592.1-1032s1c1
Sequence:CCGGCGGAGAATCTCATTGAGATCACTCGAGTGATCTCAATGAGATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-1424s1c1
Sequence:CCGGCGCTACAACAAGCTGAAGGAACTCGAGTTCCTTCAGCTTGTTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290592
VALIDATED
HIP1R MISSION shRNA shRNA Plasmid DNA
huntingtin interacting protein 1 related
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-1030s1c1
Sequence:CCGGGCCGGAGAATCTCATTGAGATCTCGAGATCTCAATGAGATTCTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:XM_290592.1-4219s1c1
Sequence:CCGGGCCCGTCAGATTTGAACGAATCTCGAGATTCGTTCAAATCTGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-3178s1c1
Sequence:CCGGCCGAAGTGTAACCACCAAGAACTCGAGTTCTTGGTGGTTACACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_290592.1-1032s1c1
Sequence:CCGGCGGAGAATCTCATTGAGATCACTCGAGTGATCTCAATGAGATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-1424s1c1
Sequence:CCGGCGCTACAACAAGCTGAAGGAACTCGAGTTCCTTCAGCTTGTTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290592
VALIDATED
HIP1R MISSION shRNA Lentiviral Transduction Particles
huntingtin interacting protein 1 related
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-1030s1c1
Sequence:CCGGGCCGGAGAATCTCATTGAGATCTCGAGATCTCAATGAGATTCTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:XM_290592.1-4219s1c1
Sequence:CCGGGCCCGTCAGATTTGAACGAATCTCGAGATTCGTTCAAATCTGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-3178s1c1
Sequence:CCGGCCGAAGTGTAACCACCAAGAACTCGAGTTCTTGGTGGTTACACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_290592.1-1032s1c1
Sequence:CCGGCGGAGAATCTCATTGAGATCACTCGAGTGATCTCAATGAGATTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290592.1-1424s1c1
Sequence:CCGGCGCTACAACAAGCTGAAGGAACTCGAGTTCCTTCAGCTTGTTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)