EMAIL THIS PAGE TO A FRIEND

HIPK1

homeodomain interacting protein kinase 1

361 Gene Product Result for
Synonyms: Myak Nbak2
Gene ID:
Human(204851) Summary: The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(15257) homeodomain interacting protein kinase 1
Rat(365895) homeodomain interacting protein kinase 1
Zebrafish(572042) homeodomain interacting protein kinase 1
domestic cat(101101070) homeodomain interacting protein kinase 1
cow(512233) homeodomain interacting protein kinase 1
chicken(419880) homeodomain interacting protein kinase 1
dog(475803) homeodomain interacting protein kinase 1
sheep(101121386) homeodomain interacting protein kinase 1
domestic guinea pig(100719004) homeodomain interacting protein kinase 1
naked mole-rat(101713252) homeodomain interacting protein kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152696 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122731 MISSION® esiRNA esiRNA human HIPK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152696 Rosetta Predictions human pricing
NM_181358 Rosetta Predictions human pricing
NM_198268 Rosetta Predictions human pricing
NM_198269 Rosetta Predictions human pricing
NM_001100986 Rosetta Predictions rat pricing
NM_010432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245412 predicted 2185
2 SASI_Hs01_00245413 predicted 2072
3 SASI_Hs01_00245414 predicted 1948
4 SASI_Hs01_00245415 predicted 1885
5 SASI_Hs01_00245416 predicted 1905
6 SASI_Hs01_00245417 predicted 1735
7 SASI_Hs01_00245418 predicted 1818
8 SASI_Hs01_00245419 predicted 1585
9 SASI_Hs01_00245420 predicted 1706
10 SASI_Hs01_00245421 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147452 predicted 905
2 SASI_Hs01_00147453 predicted 798
3 SASI_Hs01_00147454 predicted 670
4 SASI_Hs01_00147455 predicted 605
5 SASI_Hs01_00147456 predicted 628
6 SASI_Hs01_00147457 predicted 460
7 SASI_Hs01_00147458 predicted 537
8 SASI_Hs01_00147459 predicted 309
9 SASI_Hs01_00147460 predicted 428
10 SASI_Hs01_00147461 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240876 predicted 2188
2 SASI_Hs01_00240877 predicted 2080
3 SASI_Hs01_00240878 predicted 1945
4 SASI_Hs01_00240879 predicted 1887
5 SASI_Hs01_00240880 predicted 1907
6 SASI_Hs01_00240881 predicted 1740
7 SASI_Hs01_00240882 predicted 1812
8 SASI_Hs01_00240883 predicted 1588
9 SASI_Hs01_00240884 predicted 1710
10 SASI_Hs01_00240885 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036426 predicted 1090
2 SASI_Hs01_00036427 predicted 984
3 SASI_Hs01_00036428 predicted 859
4 SASI_Hs01_00036429 predicted 794
5 SASI_Hs01_00036430 predicted 813
6 SASI_Hs01_00036431 predicted 650
7 SASI_Hs01_00036432 predicted 728
8 SASI_Hs01_00036433 predicted 499
9 SASI_Hs01_00036434 predicted 616
10 SASI_Hs01_00036435 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211002 predicted 730
2 SASI_Rn02_00211003 predicted 2652
3 SASI_Rn02_00211004 predicted 1251
4 SASI_Rn02_00211005 predicted 1516
5 SASI_Rn02_00211006 predicted 863
6 SASI_Rn02_00211007 predicted 3895
7 SASI_Rn02_00211008 predicted 1843
8 SASI_Rn02_00211009 predicted 1267
9 SASI_Rn02_00211010 predicted 3788
10 SASI_Rn02_00211011 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121619 predicted 1670
2 SASI_Mm01_00121620 predicted 1022
3 SASI_Mm01_00121621 predicted 1811
4 SASI_Mm01_00121622 predicted 2753
5 SASI_Mm01_00121623 predicted 965
6 SASI_Mm01_00121624 predicted 2305
7 SASI_Mm02_00318582 predicted 1666
8 SASI_Mm01_00121625 predicted 3076
9 SASI_Mm01_00121626 predicted 1940
10 SASI_Mm02_00318583 predicted 3943
11 SASI_Mm01_00121618 predicted 3611
12 SASI_Mm01_00121627 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152696
VALIDATED
HIPK1 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-2649s1c1
Sequence:CCGGGCCCATGTTGTCAGACAACAACTCGAGTTGTTGTCTGACAACATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-1242s1c1
Sequence:CCGGCCTGAAATTATTCTTGGGTTACTCGAGTAACCCAAGAATAATTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-1747s1c1
Sequence:CCGGGCAATCATGTTAAGTCTTGTTCTCGAGAACAAGACTTAACATGATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-796s1c1
Sequence:CCGGCCAAGGAAATTGTGGCTATTACTCGAGTAATAGCCACAATTTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-1918s1c1
Sequence:CCGGCCAGTGTTCTAGCTTCCAGTTCTCGAGAACTGGAAGCTAGAACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152696.3-1955s21c1
Sequence:CCGGTACTCTTTCTCTGGCTAATTCCTCGAGGAATTAGCCAGAGAAAGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152696.3-265s21c1
Sequence:CCGGGACAGAGTAGCAACGACAAATCTCGAGATTTGTCGTTGCTACTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-2105s1c1
Sequence:CCGGCCAACAGACATTTATAGTATGCTCGAGCATACTATAAATGTCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-3011s1c1
Sequence:CCGGCAGCCCTTATTCCACTGATACCTCGAGGTATCAGTGGAATAAGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152696
VALIDATED
HIPK1 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-2649s1c1
Sequence:CCGGGCCCATGTTGTCAGACAACAACTCGAGTTGTTGTCTGACAACATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-1242s1c1
Sequence:CCGGCCTGAAATTATTCTTGGGTTACTCGAGTAACCCAAGAATAATTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-1747s1c1
Sequence:CCGGGCAATCATGTTAAGTCTTGTTCTCGAGAACAAGACTTAACATGATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-796s1c1
Sequence:CCGGCCAAGGAAATTGTGGCTATTACTCGAGTAATAGCCACAATTTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-1918s1c1
Sequence:CCGGCCAGTGTTCTAGCTTCCAGTTCTCGAGAACTGGAAGCTAGAACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152696.3-1955s21c1
Sequence:CCGGTACTCTTTCTCTGGCTAATTCCTCGAGGAATTAGCCAGAGAAAGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152696.3-265s21c1
Sequence:CCGGGACAGAGTAGCAACGACAAATCTCGAGATTTGTCGTTGCTACTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-2105s1c1
Sequence:CCGGCCAACAGACATTTATAGTATGCTCGAGCATACTATAAATGTCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-3011s1c1
Sequence:CCGGCAGCCCTTATTCCACTGATACCTCGAGGTATCAGTGGAATAAGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152696
VALIDATED
HIPK1 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-2649s1c1
Sequence:CCGGGCCCATGTTGTCAGACAACAACTCGAGTTGTTGTCTGACAACATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-1242s1c1
Sequence:CCGGCCTGAAATTATTCTTGGGTTACTCGAGTAACCCAAGAATAATTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-1747s1c1
Sequence:CCGGGCAATCATGTTAAGTCTTGTTCTCGAGAACAAGACTTAACATGATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-796s1c1
Sequence:CCGGCCAAGGAAATTGTGGCTATTACTCGAGTAATAGCCACAATTTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152696.3-1918s1c1
Sequence:CCGGCCAGTGTTCTAGCTTCCAGTTCTCGAGAACTGGAAGCTAGAACACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152696.3-1955s21c1
Sequence:CCGGTACTCTTTCTCTGGCTAATTCCTCGAGGAATTAGCCAGAGAAAGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152696.3-265s21c1
Sequence:CCGGGACAGAGTAGCAACGACAAATCTCGAGATTTGTCGTTGCTACTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-2105s1c1
Sequence:CCGGCCAACAGACATTTATAGTATGCTCGAGCATACTATAAATGTCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152696.3-3011s1c1
Sequence:CCGGCAGCCCTTATTCCACTGATACCTCGAGGTATCAGTGGAATAAGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010432
VALIDATED
HIPK1 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-3059s21c1
Sequence:CCGGAGCCTGAAGGCGAGGTCTAATCTCGAGATTAGACCTCGCCTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010432.1-2933s1c1
Sequence:CCGGGACAACAAATACGAGCCCAATCTCGAGATTGGGCTCGTATTTGTTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010432.1-1876s1c1
Sequence:CCGGCGCTCCAAATACAAGCACAAACTCGAGTTTGTGCTTGTATTTGGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010432.1-1370s1c1
Sequence:CCGGGCTTCAGAATACGATCAGATTCTCGAGAATCTGATCGTATTCTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010432.2-1474s21c1
Sequence:CCGGATACGATCAGATTCGCTATATCTCGAGATATAGCGAATCTGATCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-2077s21c1
Sequence:CCGGTACCCTTTCTCTGGCTAATTCCTCGAGGAATTAGCCAGAGAAAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-2683s21c1
Sequence:CCGGCAACCAGTACAGCACTATTATCTCGAGATAATAGTGCTGTACTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-1028s21c1
Sequence:CCGGTATAACTTTGTCCGTTCTTATCTCGAGATAAGAACGGACAAAGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010432
VALIDATED
HIPK1 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-3059s21c1
Sequence:CCGGAGCCTGAAGGCGAGGTCTAATCTCGAGATTAGACCTCGCCTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010432.1-2933s1c1
Sequence:CCGGGACAACAAATACGAGCCCAATCTCGAGATTGGGCTCGTATTTGTTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010432.1-1876s1c1
Sequence:CCGGCGCTCCAAATACAAGCACAAACTCGAGTTTGTGCTTGTATTTGGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010432.1-1370s1c1
Sequence:CCGGGCTTCAGAATACGATCAGATTCTCGAGAATCTGATCGTATTCTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010432.2-1474s21c1
Sequence:CCGGATACGATCAGATTCGCTATATCTCGAGATATAGCGAATCTGATCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-2077s21c1
Sequence:CCGGTACCCTTTCTCTGGCTAATTCCTCGAGGAATTAGCCAGAGAAAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-2683s21c1
Sequence:CCGGCAACCAGTACAGCACTATTATCTCGAGATAATAGTGCTGTACTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-1028s21c1
Sequence:CCGGTATAACTTTGTCCGTTCTTATCTCGAGATAAGAACGGACAAAGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010432
VALIDATED
HIPK1 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-3059s21c1
Sequence:CCGGAGCCTGAAGGCGAGGTCTAATCTCGAGATTAGACCTCGCCTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010432.1-2933s1c1
Sequence:CCGGGACAACAAATACGAGCCCAATCTCGAGATTGGGCTCGTATTTGTTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010432.1-1876s1c1
Sequence:CCGGCGCTCCAAATACAAGCACAAACTCGAGTTTGTGCTTGTATTTGGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010432.1-1370s1c1
Sequence:CCGGGCTTCAGAATACGATCAGATTCTCGAGAATCTGATCGTATTCTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010432.2-1474s21c1
Sequence:CCGGATACGATCAGATTCGCTATATCTCGAGATATAGCGAATCTGATCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-2077s21c1
Sequence:CCGGTACCCTTTCTCTGGCTAATTCCTCGAGGAATTAGCCAGAGAAAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-2683s21c1
Sequence:CCGGCAACCAGTACAGCACTATTATCTCGAGATAATAGTGCTGTACTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010432.2-1028s21c1
Sequence:CCGGTATAACTTTGTCCGTTCTTATCTCGAGATAAGAACGGACAAAGTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)