EMAIL THIS PAGE TO A FRIEND

HIPK2

homeodomain interacting protein kinase 2

91 Gene Product Result for
Synonyms: PRO0593
UniProtKB ID: Q9H2X6, Q75MR7, Q8WWI4, Q9H2Y1
Gene ID:
Human(28996) Summary: This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(15258) homeodomain interacting protein kinase 2
Rat(362342) homeodomain interacting protein kinase 2
domestic guinea pig(100729474) homeodomain interacting protein kinase 2
naked mole-rat(101726036) homeodomain interacting protein kinase 2
sheep(101111092) homeodomain interacting protein kinase 2
Domestic Rabbit(100359086) homeodomain interacting protein kinase 2
Zebrafish(557551) homeodomain interacting protein kinase 2
cow(510158) homeodomain interacting protein kinase 2
Horse(100064748) homeodomain interacting protein kinase 2
chicken(374138) homeodomain interacting protein kinase 2
dog(482772) homeodomain interacting protein kinase 2
domestic cat(101081031) homeodomain interacting protein kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113239 Rosetta Predictions human pricing
NM_022740 siRNAs that have been validated in the lab human pricing
NM_001108622 Rosetta Predictions rat pricing
NM_010433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325681 predicted 1187
2 SASI_Hs02_00325682 predicted 571
3 SASI_Hs02_00325683 predicted 1452
4 SASI_Hs02_00325684 predicted 228
5 SASI_Hs02_00325685 predicted 1281
6 SASI_Hs02_00325686 predicted 1453
7 SASI_Hs02_00325687 predicted 1491
8 SASI_Hs02_00325688 predicted 2398
9 SASI_Hs02_00325689 predicted 557
10 SASI_Hs02_00325690 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022740 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042453 validated 443
1 SASI_Hs01_00042452 validated 402
2 SASI_Hs02_00355978 predicted 1185
3 SASI_Hs02_00355979 predicted 568
4 SASI_Hs02_00355980 predicted 1453
5 SASI_Hs02_00355981 predicted 231
6 SASI_Hs02_00355982 predicted 1277
7 SASI_Hs02_00355983 predicted 1448
8 SASI_Hs02_00355984 predicted 1490
9 SASI_Hs01_00042455 predicted 2472
10 SASI_Hs02_00355985 predicted 556
11 SASI_Hs02_00355986 predicted 1025
12 SASI_Hs01_00042454 predicted 433
13 SASI_Hs01_00042456 predicted 1855
14 SASI_Hs01_00042457 predicted 707
15 SASI_Hs01_00042458 predicted 1839
16 SASI_Hs01_00042459 predicted 1830
17 SASI_Hs01_00042460 predicted 904
18 SASI_Hs01_00042461 predicted 1869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240449 predicted 360
2 SASI_Rn02_00240450 predicted 3010
3 SASI_Rn02_00240451 predicted 2504
4 SASI_Rn02_00240452 predicted 2393
5 SASI_Rn02_00240453 predicted 1189
6 SASI_Rn02_00240454 predicted 1370
7 SASI_Rn02_00240455 predicted 3659
8 SASI_Rn02_00240456 predicted 1548
9 SASI_Rn02_00240457 predicted 3044
10 SASI_Rn02_00240458 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047440 predicted 2103
2 SASI_Mm01_00047441 predicted 3300
3 SASI_Mm01_00047442 predicted 2680
4 SASI_Mm02_00318584 predicted 425
5 SASI_Mm01_00047443 predicted 1647
6 SASI_Mm01_00047446 predicted 3853
7 SASI_Mm01_00047447 predicted 1496
8 SASI_Mm01_00047448 predicted 2389
9 SASI_Mm02_00318585 predicted 607
10 SASI_Mm02_00318586 predicted 3350
11 SASI_Mm01_00047444 predicted 709
12 SASI_Mm01_00047445 predicted 3709
13 SASI_Mm01_00047449 predicted 2274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022740
HIPK2 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022740.4-4360s21c1
Sequence:CCGGCCTGATATGGAAATCAAATAGCTCGAGCTATTTGATTTCCATATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022740.4-4210s21c1
Sequence:CCGGAGAACCCATTCTACGCCAAACCTCGAGGTTTGGCGTAGAATGGGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022740.4-1454s21c1
Sequence:CCGGTTCCTGGGTTGGCCGTTATATCTCGAGATATAACGGCCAACCCAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022740.4-1878s21c1
Sequence:CCGGCCCACAGCACACACGTCAAATCTCGAGATTTGACGTGTGTGCTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022740.x-3956s1c1
Sequence:CCGGAGGGATTAAAGAGGGTGGGAACTCGAGTTCCCACCCTCTTTAATCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1940s1c1
Sequence:CCGGCCATACTAAACTACCCATCTACTCGAGTAGATGGGTAGTTTAGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1389s1c1
Sequence:CCGGCGGGACAAAGACAACTAGGTTCTCGAGAACCTAGTTGTCTTTGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1845s1c1
Sequence:CCGGCCTGACCATGACCTTTAACAACTCGAGTTGTTAAAGGTCATGGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-3587s1c1
Sequence:CCGGCGAGTCAGTATCCAGCCCAATCTCGAGATTGGGCTGGATACTGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022740.2-693s1c1
Sequence:CCGGCCTCTACCAGTGCCACTATTTCTCGAGAAATAGTGGCACTGGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022740.2-1169s1c1
Sequence:CCGGGCTCACGGAAGCCATTATAATCTCGAGATTATAATGGCTTCCGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022740
HIPK2 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022740.4-4360s21c1
Sequence:CCGGCCTGATATGGAAATCAAATAGCTCGAGCTATTTGATTTCCATATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022740.4-4210s21c1
Sequence:CCGGAGAACCCATTCTACGCCAAACCTCGAGGTTTGGCGTAGAATGGGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022740.4-1454s21c1
Sequence:CCGGTTCCTGGGTTGGCCGTTATATCTCGAGATATAACGGCCAACCCAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022740.4-1878s21c1
Sequence:CCGGCCCACAGCACACACGTCAAATCTCGAGATTTGACGTGTGTGCTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022740.x-3956s1c1
Sequence:CCGGAGGGATTAAAGAGGGTGGGAACTCGAGTTCCCACCCTCTTTAATCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1940s1c1
Sequence:CCGGCCATACTAAACTACCCATCTACTCGAGTAGATGGGTAGTTTAGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1389s1c1
Sequence:CCGGCGGGACAAAGACAACTAGGTTCTCGAGAACCTAGTTGTCTTTGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1845s1c1
Sequence:CCGGCCTGACCATGACCTTTAACAACTCGAGTTGTTAAAGGTCATGGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-3587s1c1
Sequence:CCGGCGAGTCAGTATCCAGCCCAATCTCGAGATTGGGCTGGATACTGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022740.2-693s1c1
Sequence:CCGGCCTCTACCAGTGCCACTATTTCTCGAGAAATAGTGGCACTGGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022740.2-1169s1c1
Sequence:CCGGGCTCACGGAAGCCATTATAATCTCGAGATTATAATGGCTTCCGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022740
HIPK2 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022740.4-4360s21c1
Sequence:CCGGCCTGATATGGAAATCAAATAGCTCGAGCTATTTGATTTCCATATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022740.4-4210s21c1
Sequence:CCGGAGAACCCATTCTACGCCAAACCTCGAGGTTTGGCGTAGAATGGGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022740.4-1454s21c1
Sequence:CCGGTTCCTGGGTTGGCCGTTATATCTCGAGATATAACGGCCAACCCAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022740.4-1878s21c1
Sequence:CCGGCCCACAGCACACACGTCAAATCTCGAGATTTGACGTGTGTGCTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022740.x-3956s1c1
Sequence:CCGGAGGGATTAAAGAGGGTGGGAACTCGAGTTCCCACCCTCTTTAATCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1940s1c1
Sequence:CCGGCCATACTAAACTACCCATCTACTCGAGTAGATGGGTAGTTTAGTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1389s1c1
Sequence:CCGGCGGGACAAAGACAACTAGGTTCTCGAGAACCTAGTTGTCTTTGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-1845s1c1
Sequence:CCGGCCTGACCATGACCTTTAACAACTCGAGTTGTTAAAGGTCATGGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022740.x-3587s1c1
Sequence:CCGGCGAGTCAGTATCCAGCCCAATCTCGAGATTGGGCTGGATACTGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022740.2-693s1c1
Sequence:CCGGCCTCTACCAGTGCCACTATTTCTCGAGAAATAGTGGCACTGGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022740.2-1169s1c1
Sequence:CCGGGCTCACGGAAGCCATTATAATCTCGAGATTATAATGGCTTCCGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010433
HIPK2 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-3866s21c1
Sequence:CCGGTTTGCCCACCAGACCTATATCCTCGAGGATATAGGTCTGGTGGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-2194s21c1
Sequence:CCGGTCCCGAAGTCTCCATACTAAACTCGAGTTTAGTATGGAGACTTCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1734s21c1
Sequence:CCGGATGAAGCAGAGACGGGAATTACTCGAGTAATTCCCGTCTCTGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1591s21c1
Sequence:CCGGGTATGATCAGATTCGGTATATCTCGAGATATACCGAATCTGATCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1132s21c1
Sequence:CCGGGAGCGCTGATGACTACAATTTCTCGAGAAATTGTAGTCATCAGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010433.2-4048s21c1
Sequence:CCGGGCACACAAACAATGCAATGGGCTCGAGCCCATTGCATTGTTTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-3063s1c1
Sequence:CCGGCCAGTGAAGTGTTGGTAGAATCTCGAGATTCTACCAACACTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-1628s1c1
Sequence:CCGGCGGGAGTTCATTGACCTGTTACTCGAGTAACAGGTCAATGAACTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-587s1c1
Sequence:CCGGCCACCCATGATTCAGAATAATCTCGAGATTATTCTGAATCATGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-3704s1c1
Sequence:CCGGGTCAACCAATACCCTTACATACTCGAGTATGTAAGGGTATTGGTTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-1461s1c1
Sequence:CCGGCGTATCCTTTGTGGAGGCTAACTCGAGTTAGCCTCCACAAAGGATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010433
HIPK2 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-3866s21c1
Sequence:CCGGTTTGCCCACCAGACCTATATCCTCGAGGATATAGGTCTGGTGGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-2194s21c1
Sequence:CCGGTCCCGAAGTCTCCATACTAAACTCGAGTTTAGTATGGAGACTTCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1734s21c1
Sequence:CCGGATGAAGCAGAGACGGGAATTACTCGAGTAATTCCCGTCTCTGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1591s21c1
Sequence:CCGGGTATGATCAGATTCGGTATATCTCGAGATATACCGAATCTGATCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1132s21c1
Sequence:CCGGGAGCGCTGATGACTACAATTTCTCGAGAAATTGTAGTCATCAGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010433.2-4048s21c1
Sequence:CCGGGCACACAAACAATGCAATGGGCTCGAGCCCATTGCATTGTTTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-3063s1c1
Sequence:CCGGCCAGTGAAGTGTTGGTAGAATCTCGAGATTCTACCAACACTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-1628s1c1
Sequence:CCGGCGGGAGTTCATTGACCTGTTACTCGAGTAACAGGTCAATGAACTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-587s1c1
Sequence:CCGGCCACCCATGATTCAGAATAATCTCGAGATTATTCTGAATCATGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-3704s1c1
Sequence:CCGGGTCAACCAATACCCTTACATACTCGAGTATGTAAGGGTATTGGTTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-1461s1c1
Sequence:CCGGCGTATCCTTTGTGGAGGCTAACTCGAGTTAGCCTCCACAAAGGATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010433
HIPK2 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-3866s21c1
Sequence:CCGGTTTGCCCACCAGACCTATATCCTCGAGGATATAGGTCTGGTGGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-2194s21c1
Sequence:CCGGTCCCGAAGTCTCCATACTAAACTCGAGTTTAGTATGGAGACTTCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1734s21c1
Sequence:CCGGATGAAGCAGAGACGGGAATTACTCGAGTAATTCCCGTCTCTGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1591s21c1
Sequence:CCGGGTATGATCAGATTCGGTATATCTCGAGATATACCGAATCTGATCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010433.2-1132s21c1
Sequence:CCGGGAGCGCTGATGACTACAATTTCTCGAGAAATTGTAGTCATCAGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010433.2-4048s21c1
Sequence:CCGGGCACACAAACAATGCAATGGGCTCGAGCCCATTGCATTGTTTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-3063s1c1
Sequence:CCGGCCAGTGAAGTGTTGGTAGAATCTCGAGATTCTACCAACACTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-1628s1c1
Sequence:CCGGCGGGAGTTCATTGACCTGTTACTCGAGTAACAGGTCAATGAACTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-587s1c1
Sequence:CCGGCCACCCATGATTCAGAATAATCTCGAGATTATTCTGAATCATGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-3704s1c1
Sequence:CCGGGTCAACCAATACCCTTACATACTCGAGTATGTAAGGGTATTGGTTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010433.1-1461s1c1
Sequence:CCGGCGTATCCTTTGTGGAGGCTAACTCGAGTTAGCCTCCACAAAGGATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)