EMAIL THIS PAGE TO A FRIEND

HIPK3

homeodomain interacting protein kinase 3

152 Gene Product Result for
Synonyms: DYRK6 FIST3 PKY YAK1
UniProtKB ID: Q9H422, O14632, Q2PBG4, Q2PBG5, Q92632, Q9HAS2
Gene ID:
Mouse(15259) homeodomain interacting protein kinase 3
Rat(83617) homeodomain interacting protein kinase 3
chicken(421597) homeodomain interacting protein kinase 3
domestic cat(101091475) homeodomain interacting protein kinase 3
cow(538866) homeodomain interacting protein kinase 3
Horse(100059137) homeodomain interacting protein kinase 3
dog(475947) homeodomain interacting protein kinase 3
sheep(101123406) homeodomain interacting protein kinase 3
Domestic Rabbit(100339292) homeodomain interacting protein kinase 3
domestic guinea pig(100727279) homeodomain interacting protein kinase 3
naked mole-rat(101712269) homeodomain interacting protein kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0530 AQUA Peptide (CM-Cys)AGPEAV[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005734 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019941 MISSION® esiRNA esiRNA human HIPK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048200 Rosetta Predictions human pricing
NM_005734 siRNAs that have been validated in the lab human pricing
NM_031787 Rosetta Predictions rat pricing
NM_010434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311662 predicted 3607
2 SASI_Hs02_00311663 predicted 884
3 SASI_Hs02_00311664 predicted 3729
4 SASI_Hs02_00311665 predicted 853
5 SASI_Hs02_00311666 predicted 3448
6 SASI_Hs02_00311667 predicted 379
7 SASI_Hs02_00311668 predicted 3451
8 SASI_Hs02_00311669 predicted 698
9 SASI_Hs02_00311670 predicted 683
10 SASI_Hs02_00311671 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005734 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121923 validated 881
2 SASI_Hs01_00121921 predicted 3670
3 SASI_Hs02_00340169 predicted 3791
4 SASI_Hs01_00121925 predicted 852
5 SASI_Hs01_00121927 predicted 3510
6 SASI_Hs02_00340170 predicted 380
7 SASI_Hs01_00121929 predicted 3512
8 SASI_Hs01_00121930 predicted 693
9 SASI_Hs02_00340171 predicted 684
10 SASI_Hs02_00340172 predicted 740
11 SASI_Hs01_00121922 predicted 1287
12 SASI_Hs01_00121924 predicted 2512
13 SASI_Hs01_00121926 predicted 2674
14 SASI_Hs01_00121928 predicted 2831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081375 predicted 1982
2 SASI_Rn01_00081376 predicted 2037
3 SASI_Rn01_00081377 predicted 1000
4 SASI_Rn02_00265227 predicted 2369
5 SASI_Rn02_00265228 predicted 1436
6 SASI_Rn01_00081378 predicted 3586
7 SASI_Rn01_00081379 predicted 3639
8 SASI_Rn01_00081380 predicted 1882
9 SASI_Rn01_00081381 predicted 3642
10 SASI_Rn01_00081382 predicted 2155
11 SASI_Rn01_00081383 predicted 3611
12 SASI_Rn01_00081384 predicted 3620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096561 predicted 3464
2 SASI_Mm01_00096562 predicted 2236
3 SASI_Mm01_00096563 predicted 2216
4 SASI_Mm01_00096564 predicted 1814
5 SASI_Mm01_00096565 predicted 2307
6 SASI_Mm01_00096566 predicted 2047
7 SASI_Mm01_00096567 predicted 1362
8 SASI_Mm01_00096568 predicted 638
9 SASI_Mm01_00096569 predicted 401
10 SASI_Mm01_00096570 predicted 3477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010434
VALIDATED
HIPK3 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-1758s21c1
Sequence:CCGGATGATCAGATCCGATACATTTCTCGAGAAATGTATCGGATCTGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-4336s21c1
Sequence:CCGGTCTTATGTAGTAACTCTATAGCTCGAGCTATAGAGTTACTACATAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-3697s21c1
Sequence:CCGGTCGAAGACAGCAAGCATATATCTCGAGATATATGCTTGCTGTCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-2891s1c1
Sequence:CCGGCGAGAGTGTAAAGGTAGTCTACTCGAGTAGACTACCTTTACACTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010434.1-3501s1c1
Sequence:CCGGCGCTTTCTCATGGAAGTCCTACTCGAGTAGGACTTCCATGAGAAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-536s1c1
Sequence:CCGGGCAGGTGCCATTGTTGTCAAACTCGAGTTTGACAACAATGGCACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-2387s1c1
Sequence:CCGGGCCGCAACACTAACTTCTGAACTCGAGTTCAGAAGTTAGTGTTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-3747s21c1
Sequence:CCGGCGCTTTCTCATGGAAGTCCTACTCGAGTAGGACTTCCATGAGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-2103s21c1
Sequence:CCGGTGAACCACCCATTCGTTAATACTCGAGTATTAACGAATGGGTGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010434
VALIDATED
HIPK3 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-1758s21c1
Sequence:CCGGATGATCAGATCCGATACATTTCTCGAGAAATGTATCGGATCTGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-4336s21c1
Sequence:CCGGTCTTATGTAGTAACTCTATAGCTCGAGCTATAGAGTTACTACATAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-3697s21c1
Sequence:CCGGTCGAAGACAGCAAGCATATATCTCGAGATATATGCTTGCTGTCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-2891s1c1
Sequence:CCGGCGAGAGTGTAAAGGTAGTCTACTCGAGTAGACTACCTTTACACTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010434.1-3501s1c1
Sequence:CCGGCGCTTTCTCATGGAAGTCCTACTCGAGTAGGACTTCCATGAGAAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-536s1c1
Sequence:CCGGGCAGGTGCCATTGTTGTCAAACTCGAGTTTGACAACAATGGCACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-2387s1c1
Sequence:CCGGGCCGCAACACTAACTTCTGAACTCGAGTTCAGAAGTTAGTGTTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-3747s21c1
Sequence:CCGGCGCTTTCTCATGGAAGTCCTACTCGAGTAGGACTTCCATGAGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-2103s21c1
Sequence:CCGGTGAACCACCCATTCGTTAATACTCGAGTATTAACGAATGGGTGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010434
VALIDATED
HIPK3 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-1758s21c1
Sequence:CCGGATGATCAGATCCGATACATTTCTCGAGAAATGTATCGGATCTGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-4336s21c1
Sequence:CCGGTCTTATGTAGTAACTCTATAGCTCGAGCTATAGAGTTACTACATAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-3697s21c1
Sequence:CCGGTCGAAGACAGCAAGCATATATCTCGAGATATATGCTTGCTGTCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-2891s1c1
Sequence:CCGGCGAGAGTGTAAAGGTAGTCTACTCGAGTAGACTACCTTTACACTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010434.1-3501s1c1
Sequence:CCGGCGCTTTCTCATGGAAGTCCTACTCGAGTAGGACTTCCATGAGAAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-536s1c1
Sequence:CCGGGCAGGTGCCATTGTTGTCAAACTCGAGTTTGACAACAATGGCACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010434.1-2387s1c1
Sequence:CCGGGCCGCAACACTAACTTCTGAACTCGAGTTCAGAAGTTAGTGTTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-3747s21c1
Sequence:CCGGCGCTTTCTCATGGAAGTCCTACTCGAGTAGGACTTCCATGAGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010434.2-2103s21c1
Sequence:CCGGTGAACCACCCATTCGTTAATACTCGAGTATTAACGAATGGGTGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005734
VALIDATED
HIPK3 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-3894s21c2
Sequence:CCGGACTCAGCCAGTATCCATATATCTCGAGATATATGGATACTGGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-2798s1c1
Sequence:CCGGCCTGCAAGAGACCGAATAGTACTCGAGTACTATTCGGTCTCTTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005734.x-1766s1c1
Sequence:CCGGGAACATTAAGAAGTCAGGCATCTCGAGATGCCTGACTTCTTAATGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-2302s1c1
Sequence:CCGGCAGTGCCAGAACAGAGGTATTCTCGAGAATACCTCTGTTCTGGCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-3356s1c1
Sequence:CCGGCTACTCTACTTCCATACCCATCTCGAGATGGGTATGGAAGTAGAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-1648s1c1
Sequence:CCGGGATATTTGTAAGTCCCACCTACTCGAGTAGGTGGGACTTACAAATATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005734.2-1144s1c1
Sequence:CCGGGCCATAGACATGTGGTCATTGCTCGAGCAATGACCACATGTCTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-3253s1c1
Sequence:CCGGCCTACTAGTGTTACCAGTAATCTCGAGATTACTGGTAACACTAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-889s21c2
Sequence:CCGGACGTTTGGCCAGGTAGTTAAACTCGAGTTTAACTACCTGGCCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-2647s21c2
Sequence:CCGGTCATTACAGAATACCAATATCCTCGAGGATATTGGTATTCTGTAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005734.3-4023s21c2
Sequence:GTACCGGTAGACTTGGGTGCAATTTAAACTCGAGTTTAAATTGCACCCAAGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-133s1c1
Sequence:CCGGCGGACCTATGTGAATGGTAGACTCGAGTCTACCATTCACATAGGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-3496s1c1
Sequence:CCGGCAAGTCCCAGTGGGCTTAAATCTCGAGATTTAAGCCCACTGGGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-970s21c2
Sequence:CCGGTATGCCCGTCAAGGTCAAATACTCGAGTATTTGACCTTGACGGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005734
VALIDATED
HIPK3 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-3894s21c2
Sequence:CCGGACTCAGCCAGTATCCATATATCTCGAGATATATGGATACTGGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-2798s1c1
Sequence:CCGGCCTGCAAGAGACCGAATAGTACTCGAGTACTATTCGGTCTCTTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005734.x-1766s1c1
Sequence:CCGGGAACATTAAGAAGTCAGGCATCTCGAGATGCCTGACTTCTTAATGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-2302s1c1
Sequence:CCGGCAGTGCCAGAACAGAGGTATTCTCGAGAATACCTCTGTTCTGGCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-3356s1c1
Sequence:CCGGCTACTCTACTTCCATACCCATCTCGAGATGGGTATGGAAGTAGAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-1648s1c1
Sequence:CCGGGATATTTGTAAGTCCCACCTACTCGAGTAGGTGGGACTTACAAATATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005734.2-1144s1c1
Sequence:CCGGGCCATAGACATGTGGTCATTGCTCGAGCAATGACCACATGTCTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-3253s1c1
Sequence:CCGGCCTACTAGTGTTACCAGTAATCTCGAGATTACTGGTAACACTAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-889s21c2
Sequence:CCGGACGTTTGGCCAGGTAGTTAAACTCGAGTTTAACTACCTGGCCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-2647s21c2
Sequence:CCGGTCATTACAGAATACCAATATCCTCGAGGATATTGGTATTCTGTAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005734.3-4023s21c2
Sequence:GTACCGGTAGACTTGGGTGCAATTTAAACTCGAGTTTAAATTGCACCCAAGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-133s1c1
Sequence:CCGGCGGACCTATGTGAATGGTAGACTCGAGTCTACCATTCACATAGGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-3496s1c1
Sequence:CCGGCAAGTCCCAGTGGGCTTAAATCTCGAGATTTAAGCCCACTGGGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-970s21c2
Sequence:CCGGTATGCCCGTCAAGGTCAAATACTCGAGTATTTGACCTTGACGGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005734
VALIDATED
HIPK3 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-3894s21c2
Sequence:CCGGACTCAGCCAGTATCCATATATCTCGAGATATATGGATACTGGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-2798s1c1
Sequence:CCGGCCTGCAAGAGACCGAATAGTACTCGAGTACTATTCGGTCTCTTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005734.x-1766s1c1
Sequence:CCGGGAACATTAAGAAGTCAGGCATCTCGAGATGCCTGACTTCTTAATGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-2302s1c1
Sequence:CCGGCAGTGCCAGAACAGAGGTATTCTCGAGAATACCTCTGTTCTGGCACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-3356s1c1
Sequence:CCGGCTACTCTACTTCCATACCCATCTCGAGATGGGTATGGAAGTAGAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.x-1648s1c1
Sequence:CCGGGATATTTGTAAGTCCCACCTACTCGAGTAGGTGGGACTTACAAATATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005734.2-1144s1c1
Sequence:CCGGGCCATAGACATGTGGTCATTGCTCGAGCAATGACCACATGTCTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-3253s1c1
Sequence:CCGGCCTACTAGTGTTACCAGTAATCTCGAGATTACTGGTAACACTAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-889s21c2
Sequence:CCGGACGTTTGGCCAGGTAGTTAAACTCGAGTTTAACTACCTGGCCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-2647s21c2
Sequence:CCGGTCATTACAGAATACCAATATCCTCGAGGATATTGGTATTCTGTAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005734.3-4023s21c2
Sequence:GTACCGGTAGACTTGGGTGCAATTTAAACTCGAGTTTAAATTGCACCCAAGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-133s1c1
Sequence:CCGGCGGACCTATGTGAATGGTAGACTCGAGTCTACCATTCACATAGGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005734.2-3496s1c1
Sequence:CCGGCAAGTCCCAGTGGGCTTAAATCTCGAGATTTAAGCCCACTGGGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005734.3-970s21c2
Sequence:CCGGTATGCCCGTCAAGGTCAAATACTCGAGTATTTGACCTTGACGGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)