EMAIL THIS PAGE TO A FRIEND

HIPK4

homeodomain interacting protein kinase 4

82 Gene Product Result for
UniProtKB ID: Q8NE63, A8K863, Q96M54
Gene ID:
Mouse(233020) homeodomain interacting protein kinase 4
Rat(308449) homeodomain interacting protein kinase 4
cow(520157) homeodomain interacting protein kinase 4
domestic cat(101093479) homeodomain interacting protein kinase 4
dog(476458) homeodomain interacting protein kinase 4
domestic guinea pig(100722857) homeodomain interacting protein kinase 4
naked mole-rat(101721874) homeodomain interacting protein kinase 4
sheep(101118810) homeodomain interacting protein kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144685 Rosetta Predictions human pricing
NM_001024776 Rosetta Predictions rat pricing
NM_001033315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052908 predicted 1918
2 SASI_Hs01_00052909 predicted 1159
3 SASI_Hs01_00052910 predicted 757
4 SASI_Hs01_00052911 predicted 1616
5 SASI_Hs01_00052912 predicted 1537
6 SASI_Hs01_00052913 predicted 2227
7 SASI_Hs01_00052914 predicted 1111
8 SASI_Hs01_00052915 predicted 1535
9 SASI_Hs01_00052916 predicted 1017
10 SASI_Hs02_00364589 predicted 2202
11 SASI_Hs01_00052917 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061232 predicted 2064
2 SASI_Rn01_00061233 predicted 2147
3 SASI_Rn01_00061234 predicted 723
4 SASI_Rn01_00061235 predicted 2067
5 SASI_Rn01_00061236 predicted 1211
6 SASI_Rn01_00061237 predicted 394
7 SASI_Rn01_00061238 predicted 1682
8 SASI_Rn01_00061239 predicted 491
9 SASI_Rn01_00061240 predicted 758
10 SASI_Rn01_00061241 predicted 1905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067697 predicted 1602
2 SASI_Mm01_00067700 predicted 1692
3 SASI_Mm02_00288521 predicted 727
4 SASI_Mm01_00067702 predicted 1680
5 SASI_Mm01_00067703 predicted 2173
6 SASI_Mm02_00288522 predicted 2191
7 SASI_Mm02_00288523 predicted 891
8 SASI_Mm02_00288524 predicted 756
9 SASI_Mm02_00288525 predicted 768
10 SASI_Mm02_00288526 predicted 467
11 SASI_Mm01_00067696 predicted 1495
12 SASI_Mm01_00067698 predicted 1648
13 SASI_Mm01_00067699 predicted 1664
14 SASI_Mm01_00067701 predicted 1870
15 SASI_Mm01_00067704 predicted 1513
16 SASI_Mm01_00067705 predicted 2711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033315
HIPK4 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000378355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-731s21c1
Sequence:CCGGTTTGGCTCGGCCAGCATATTCCTCGAGGAATATGCTGGCCGAGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-1096s21c1
Sequence:CCGGCCGCAAGTACATGCTCAAATCCTCGAGGATTTGAGCATGTACTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-894s21c1
Sequence:CCGGCTCTCTACCCAGGCAACAATGCTCGAGCATTGTTGCCTGGGTAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033315.2-2200s21c1
Sequence:CCGGGAACCTACAGATTATTCTTACCTCGAGGTAAGAATAATCTGTAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033315
HIPK4 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000378355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-731s21c1
Sequence:CCGGTTTGGCTCGGCCAGCATATTCCTCGAGGAATATGCTGGCCGAGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-1096s21c1
Sequence:CCGGCCGCAAGTACATGCTCAAATCCTCGAGGATTTGAGCATGTACTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-894s21c1
Sequence:CCGGCTCTCTACCCAGGCAACAATGCTCGAGCATTGTTGCCTGGGTAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033315.2-2200s21c1
Sequence:CCGGGAACCTACAGATTATTCTTACCTCGAGGTAAGAATAATCTGTAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033315
HIPK4 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000378355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-731s21c1
Sequence:CCGGTTTGGCTCGGCCAGCATATTCCTCGAGGAATATGCTGGCCGAGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-1096s21c1
Sequence:CCGGCCGCAAGTACATGCTCAAATCCTCGAGGATTTGAGCATGTACTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033315.2-894s21c1
Sequence:CCGGCTCTCTACCCAGGCAACAATGCTCGAGCATTGTTGCCTGGGTAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033315.2-2200s21c1
Sequence:CCGGGAACCTACAGATTATTCTTACCTCGAGGTAAGAATAATCTGTAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144685
HIPK4 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144685.3-2220s21c1
Sequence:CCGGATCTCCTGAACCCACAAATTACTCGAGTAATTTGTGGGTTCAGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144685.3-1910s21c1
Sequence:CCGGATGAGGATGGGCCCAACATTGCTCGAGCAATGTTGGGCCCATCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144685.3-2249s21c1
Sequence:CCGGGAAAGATAGTTATCCAGAAATCTCGAGATTTCTGGATAACTATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144685.3-2312s1c1
Sequence:CCGGTCCTAAACACAGCAGGGCTTTCTCGAGAAAGCCCTGCTGTGTTTAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144685.3-1124s1c1
Sequence:CCGGGCCGCAAGTATATGCTCAAGTCTCGAGACTTGAGCATATACTTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144685.3-505s1c1
Sequence:CCGGCGCTTCCTTGAGTTCTTCCATCTCGAGATGGAAGAACTCAAGGAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144685.3-1071s1c1
Sequence:CCGGGCTCAAGTCCTCGGCTGACTACTCGAGTAGTCAGCCGAGGACTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144685.3-792s1c1
Sequence:CCGGCTACGTGAAGGAGCCATACATCTCGAGATGTATGGCTCCTTCACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144685
HIPK4 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144685.3-2220s21c1
Sequence:CCGGATCTCCTGAACCCACAAATTACTCGAGTAATTTGTGGGTTCAGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144685.3-1910s21c1
Sequence:CCGGATGAGGATGGGCCCAACATTGCTCGAGCAATGTTGGGCCCATCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144685.3-2249s21c1
Sequence:CCGGGAAAGATAGTTATCCAGAAATCTCGAGATTTCTGGATAACTATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144685.3-2312s1c1
Sequence:CCGGTCCTAAACACAGCAGGGCTTTCTCGAGAAAGCCCTGCTGTGTTTAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144685.3-1124s1c1
Sequence:CCGGGCCGCAAGTATATGCTCAAGTCTCGAGACTTGAGCATATACTTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144685.3-505s1c1
Sequence:CCGGCGCTTCCTTGAGTTCTTCCATCTCGAGATGGAAGAACTCAAGGAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144685.3-1071s1c1
Sequence:CCGGGCTCAAGTCCTCGGCTGACTACTCGAGTAGTCAGCCGAGGACTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144685.3-792s1c1
Sequence:CCGGCTACGTGAAGGAGCCATACATCTCGAGATGTATGGCTCCTTCACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144685
HIPK4 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144685.3-2220s21c1
Sequence:CCGGATCTCCTGAACCCACAAATTACTCGAGTAATTTGTGGGTTCAGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144685.3-1910s21c1
Sequence:CCGGATGAGGATGGGCCCAACATTGCTCGAGCAATGTTGGGCCCATCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144685.3-2249s21c1
Sequence:CCGGGAAAGATAGTTATCCAGAAATCTCGAGATTTCTGGATAACTATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144685.3-2312s1c1
Sequence:CCGGTCCTAAACACAGCAGGGCTTTCTCGAGAAAGCCCTGCTGTGTTTAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144685.3-1124s1c1
Sequence:CCGGGCCGCAAGTATATGCTCAAGTCTCGAGACTTGAGCATATACTTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144685.3-505s1c1
Sequence:CCGGCGCTTCCTTGAGTTCTTCCATCTCGAGATGGAAGAACTCAAGGAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144685.3-1071s1c1
Sequence:CCGGGCTCAAGTCCTCGGCTGACTACTCGAGTAGTCAGCCGAGGACTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144685.3-792s1c1
Sequence:CCGGCTACGTGAAGGAGCCATACATCTCGAGATGTATGGCTCCTTCACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133316
HIPK4 MISSION shRNA Bacterial Glycerol Stock
homeodomain interacting protein kinase 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000022993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-142s1c1
Sequence:CCGGCGAAGCCGCATCATCAAGAATCTCGAGATTCTTGATGATGCGGCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-839s1c1
Sequence:CCGGGCCGCAAGTACATGCTCAAATCTCGAGATTTGAGCATGTACTTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-484s1c1
Sequence:CCGGGCCAGCATATTCAGTGAGGTACTCGAGTACCTCACTGAATATGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-246s1c1
Sequence:CCGGCCTCAAGTTCTACCTGGTCTTCTCGAGAAGACCAGGTAGAACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133316
HIPK4 MISSION shRNA shRNA Plasmid DNA
homeodomain interacting protein kinase 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000022993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-142s1c1
Sequence:CCGGCGAAGCCGCATCATCAAGAATCTCGAGATTCTTGATGATGCGGCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-839s1c1
Sequence:CCGGGCCGCAAGTACATGCTCAAATCTCGAGATTTGAGCATGTACTTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-484s1c1
Sequence:CCGGGCCAGCATATTCAGTGAGGTACTCGAGTACCTCACTGAATATGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-246s1c1
Sequence:CCGGCCTCAAGTTCTACCTGGTCTTCTCGAGAAGACCAGGTAGAACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133316
HIPK4 MISSION shRNA Lentiviral Transduction Particles
homeodomain interacting protein kinase 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000022993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-142s1c1
Sequence:CCGGCGAAGCCGCATCATCAAGAATCTCGAGATTCTTGATGATGCGGCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-839s1c1
Sequence:CCGGGCCGCAAGTACATGCTCAAATCTCGAGATTTGAGCATGTACTTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-484s1c1
Sequence:CCGGGCCAGCATATTCAGTGAGGTACTCGAGTACCTCACTGAATATGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133316.3-246s1c1
Sequence:CCGGCCTCAAGTTCTACCTGGTCTTCTCGAGAAGACCAGGTAGAACTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)