EMAIL THIS PAGE TO A FRIEND

HIRA

histone cell cycle regulator

103 Gene Product Result for
Synonyms: DGCR1 TUP1 TUPLE1
UniProtKB ID: P54198, Q05BU9, Q8IXN2
Gene ID:
Human(7290) Summary: This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
Mouse(15260) histone cell cycle regulation defective homolog A (S. cerevisiae)
Rat(363849) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
Zebrafish(568076) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
fruit fly(31680) CG12153 gene product from transcript CG12153-RA
cow(511514) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
Horse(100052845) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
domestic cat(101098170) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
dog(486424) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
Thale Cress(823578) protein HIRA
chicken(374074) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
sheep(101120607) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
Domestic Rabbit(100352472) HIR histone cell cycle regulation defective homolog A (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003325 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003325 Rosetta Predictions human pricing
XM_001062924 Rosetta Predictions rat pricing
XM_344057 Rosetta Predictions rat pricing
NM_001005228 Rosetta Predictions mouse pricing
NM_010435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094109 predicted 1003
2 SASI_Hs02_00335468 predicted 1528
3 SASI_Hs01_00094110 predicted 445
4 SASI_Hs01_00094111 predicted 790
5 SASI_Hs02_00335469 predicted 1002
6 SASI_Hs02_00335470 predicted 775
7 SASI_Hs01_00094113 predicted 1811
8 SASI_Hs01_00094114 predicted 1903
9 SASI_Hs01_00094116 predicted 2938
10 SASI_Hs01_00094117 predicted 1201
11 SASI_Hs01_00094112 predicted 3097
12 SASI_Hs01_00094115 predicted 1186
13 SASI_Hs01_00094118 predicted 2718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305099 predicted 1286
2 SASI_Rn02_00305100 predicted 1710
3 SASI_Rn02_00305101 predicted 3346
4 SASI_Rn02_00305102 predicted 938
5 SASI_Rn02_00305103 predicted 1821
6 SASI_Rn02_00305104 predicted 2388
7 SASI_Rn02_00305105 predicted 1331
8 SASI_Rn02_00305106 predicted 1191
9 SASI_Rn02_00305107 predicted 1154
10 SASI_Rn02_00305108 predicted 3153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162013 predicted 1280
2 SASI_Rn01_00162014 predicted 1715
3 SASI_Rn01_00162015 predicted 3342
4 SASI_Rn01_00162016 predicted 935
5 SASI_Rn01_00162017 predicted 1817
6 SASI_Rn01_00162018 predicted 2394
7 SASI_Rn01_00162019 predicted 1334
8 SASI_Rn02_00396781 predicted 1189
9 SASI_Rn01_00162020 predicted 1151
10 SASI_Rn01_00162021 predicted 3155
11 SASI_Rn01_00162022 predicted 3628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139503 predicted 1218
2 SASI_Mm01_00139504 predicted 1013
3 SASI_Mm01_00139505 predicted 947
4 SASI_Mm01_00139506 predicted 1436
5 SASI_Mm01_00139507 predicted 1543
6 SASI_Mm01_00139508 predicted 1614
7 SASI_Mm01_00139509 predicted 880
8 SASI_Mm01_00139510 predicted 755
9 SASI_Mm01_00139511 predicted 1242
10 SASI_Mm01_00139512 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104742 predicted 1518
2 SASI_Mm01_00104743 predicted 1315
3 SASI_Mm01_00104744 predicted 1238
4 SASI_Mm01_00104745 predicted 1734
5 SASI_Mm02_00318587 predicted 957
6 SASI_Mm02_00318588 predicted 2314
7 SASI_Mm02_00318589 predicted 2338
8 SASI_Mm02_00318590 predicted 2480
9 SASI_Mm01_00104746 predicted 1847
10 SASI_Mm01_00104748 predicted 1176
11 SASI_Mm01_00104747 predicted 1909
12 SASI_Mm01_00104749 predicted 1050
13 SASI_Mm01_00104750 predicted 1547
14 SASI_Mm01_00104751 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010435
VALIDATED
HIRA MISSION shRNA Bacterial Glycerol Stock
histone cell cycle regulator
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-1415s1c1
Sequence:CCGGCCAGCTTTCCACAGCTGTTATCTCGAGATAACAGCTGTGGAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1274s21c1
Sequence:CCGGACTTGGGATCCCGTTGGTAAACTCGAGTTTACCAACGGGATCCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-726s1c1
Sequence:CCGGGCCGTGAAGTTCCCAGAAATTCTCGAGAATTTCTGGGAACTTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-991s1c1
Sequence:CCGGCCACTGCTCAGATCATCGAAACTCGAGTTTCGATGATCTGAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-820s1c1
Sequence:CCGGCTCAAGCTGATGATCGAAGTTCTCGAGAACTTCGATCATCAGCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-817s1c1
Sequence:CCGGCCTCTCAAGCTGATGATCGAACTCGAGTTCGATCATCAGCTTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010435.2-3935s21c1
Sequence:CCGGTGGGTGGACATGGACTATATCCTCGAGGATATAGTCCATGTCCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1246s21c1
Sequence:CCGGAGGTCATTCTGGCTTAGTAAACTCGAGTTTACTAAGCCAGAATGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-3720s21c1
Sequence:CCGGTTCGATTCCAGCGCCTCTTTACTCGAGTAAAGAGGCGCTGGAATCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-3373s21c1
Sequence:CCGGTTCAGGACCGTTAGCCATAATCTCGAGATTATGGCTAACGGTCCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1716s21c1
Sequence:CCGGACAAGTCCATCATGGATATTTCTCGAGAAATATCCATGATGGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010435.2-3581s21c1
Sequence:CCGGGAATACCGCCTCCGTGAAATACTCGAGTATTTCACGGAGGCGGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1185s21c1
Sequence:CCGGTGGATAACACTGTTGTCATTTCTCGAGAAATGACAACAGTGTTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010435
VALIDATED
HIRA MISSION shRNA shRNA Plasmid DNA
histone cell cycle regulator
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-1415s1c1
Sequence:CCGGCCAGCTTTCCACAGCTGTTATCTCGAGATAACAGCTGTGGAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1274s21c1
Sequence:CCGGACTTGGGATCCCGTTGGTAAACTCGAGTTTACCAACGGGATCCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-726s1c1
Sequence:CCGGGCCGTGAAGTTCCCAGAAATTCTCGAGAATTTCTGGGAACTTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-991s1c1
Sequence:CCGGCCACTGCTCAGATCATCGAAACTCGAGTTTCGATGATCTGAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-820s1c1
Sequence:CCGGCTCAAGCTGATGATCGAAGTTCTCGAGAACTTCGATCATCAGCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-817s1c1
Sequence:CCGGCCTCTCAAGCTGATGATCGAACTCGAGTTCGATCATCAGCTTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010435.2-3935s21c1
Sequence:CCGGTGGGTGGACATGGACTATATCCTCGAGGATATAGTCCATGTCCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1246s21c1
Sequence:CCGGAGGTCATTCTGGCTTAGTAAACTCGAGTTTACTAAGCCAGAATGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-3720s21c1
Sequence:CCGGTTCGATTCCAGCGCCTCTTTACTCGAGTAAAGAGGCGCTGGAATCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-3373s21c1
Sequence:CCGGTTCAGGACCGTTAGCCATAATCTCGAGATTATGGCTAACGGTCCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1716s21c1
Sequence:CCGGACAAGTCCATCATGGATATTTCTCGAGAAATATCCATGATGGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010435.2-3581s21c1
Sequence:CCGGGAATACCGCCTCCGTGAAATACTCGAGTATTTCACGGAGGCGGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1185s21c1
Sequence:CCGGTGGATAACACTGTTGTCATTTCTCGAGAAATGACAACAGTGTTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010435
VALIDATED
HIRA MISSION shRNA Lentiviral Transduction Particles
histone cell cycle regulator
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-1415s1c1
Sequence:CCGGCCAGCTTTCCACAGCTGTTATCTCGAGATAACAGCTGTGGAAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1274s21c1
Sequence:CCGGACTTGGGATCCCGTTGGTAAACTCGAGTTTACCAACGGGATCCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-726s1c1
Sequence:CCGGGCCGTGAAGTTCCCAGAAATTCTCGAGAATTTCTGGGAACTTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-991s1c1
Sequence:CCGGCCACTGCTCAGATCATCGAAACTCGAGTTTCGATGATCTGAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-820s1c1
Sequence:CCGGCTCAAGCTGATGATCGAAGTTCTCGAGAACTTCGATCATCAGCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010435.1-817s1c1
Sequence:CCGGCCTCTCAAGCTGATGATCGAACTCGAGTTCGATCATCAGCTTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010435.2-3935s21c1
Sequence:CCGGTGGGTGGACATGGACTATATCCTCGAGGATATAGTCCATGTCCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1246s21c1
Sequence:CCGGAGGTCATTCTGGCTTAGTAAACTCGAGTTTACTAAGCCAGAATGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-3720s21c1
Sequence:CCGGTTCGATTCCAGCGCCTCTTTACTCGAGTAAAGAGGCGCTGGAATCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-3373s21c1
Sequence:CCGGTTCAGGACCGTTAGCCATAATCTCGAGATTATGGCTAACGGTCCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1716s21c1
Sequence:CCGGACAAGTCCATCATGGATATTTCTCGAGAAATATCCATGATGGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010435.2-3581s21c1
Sequence:CCGGGAATACCGCCTCCGTGAAATACTCGAGTATTTCACGGAGGCGGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010435.2-1185s21c1
Sequence:CCGGTGGATAACACTGTTGTCATTTCTCGAGAAATGACAACAGTGTTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003325
VALIDATED
HIRA MISSION shRNA Bacterial Glycerol Stock
histone cell cycle regulator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-592s21c1
Sequence:CCGGCTCTATCCTCCGGAATCATTCCTCGAGGAATGATTCCGGAGGATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-670s1c1
Sequence:CCGGCGTGGATAACACTGTCGTCATCTCGAGATGACGACAGTGTTATCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-1808s1c1
Sequence:CCGGGCAGGCGATTCTGTCAATAAACTCGAGTTTATTGACAGAATCGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003325.3-3086s1c1
Sequence:CCGGCGAGAAATATGCAAGGACTTACTCGAGTAAGTCCTTGCATATTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003325.3-3629s1c1
Sequence:CCGGGCAGTGACGATTGAGCCATTTCTCGAGAAATGGCTCAATCGTCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-744s1c1
Sequence:CCGGGCTTGGTCAAAGGGTTGACATCTCGAGATGTCAACCCTTTGACCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-2867s21c1
Sequence:CCGGTCAGGACCGTTAGCCATAATCCTCGAGGATTATGGCTAACGGTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-3660s21c1
Sequence:CCGGATCCGGAAGCGTTAGGTATTACTCGAGTAATACCTAACGCTTCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-3073s21c1
Sequence:CCGGTGAATACCGACTTCGAGAAATCTCGAGATTTCTCGAAGTCGGTATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003325.3-1203s21c1
Sequence:CCGGACAAATCCATCATGGATATTTCTCGAGAAATATCCATGATGGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003325
VALIDATED
HIRA MISSION shRNA shRNA Plasmid DNA
histone cell cycle regulator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-592s21c1
Sequence:CCGGCTCTATCCTCCGGAATCATTCCTCGAGGAATGATTCCGGAGGATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-670s1c1
Sequence:CCGGCGTGGATAACACTGTCGTCATCTCGAGATGACGACAGTGTTATCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-1808s1c1
Sequence:CCGGGCAGGCGATTCTGTCAATAAACTCGAGTTTATTGACAGAATCGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003325.3-3086s1c1
Sequence:CCGGCGAGAAATATGCAAGGACTTACTCGAGTAAGTCCTTGCATATTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003325.3-3629s1c1
Sequence:CCGGGCAGTGACGATTGAGCCATTTCTCGAGAAATGGCTCAATCGTCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-744s1c1
Sequence:CCGGGCTTGGTCAAAGGGTTGACATCTCGAGATGTCAACCCTTTGACCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-2867s21c1
Sequence:CCGGTCAGGACCGTTAGCCATAATCCTCGAGGATTATGGCTAACGGTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-3660s21c1
Sequence:CCGGATCCGGAAGCGTTAGGTATTACTCGAGTAATACCTAACGCTTCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-3073s21c1
Sequence:CCGGTGAATACCGACTTCGAGAAATCTCGAGATTTCTCGAAGTCGGTATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003325.3-1203s21c1
Sequence:CCGGACAAATCCATCATGGATATTTCTCGAGAAATATCCATGATGGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003325
VALIDATED
HIRA MISSION shRNA Lentiviral Transduction Particles
histone cell cycle regulator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-592s21c1
Sequence:CCGGCTCTATCCTCCGGAATCATTCCTCGAGGAATGATTCCGGAGGATAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-670s1c1
Sequence:CCGGCGTGGATAACACTGTCGTCATCTCGAGATGACGACAGTGTTATCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-1808s1c1
Sequence:CCGGGCAGGCGATTCTGTCAATAAACTCGAGTTTATTGACAGAATCGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003325.3-3086s1c1
Sequence:CCGGCGAGAAATATGCAAGGACTTACTCGAGTAAGTCCTTGCATATTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003325.3-3629s1c1
Sequence:CCGGGCAGTGACGATTGAGCCATTTCTCGAGAAATGGCTCAATCGTCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003325.3-744s1c1
Sequence:CCGGGCTTGGTCAAAGGGTTGACATCTCGAGATGTCAACCCTTTGACCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-2867s21c1
Sequence:CCGGTCAGGACCGTTAGCCATAATCCTCGAGGATTATGGCTAACGGTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-3660s21c1
Sequence:CCGGATCCGGAAGCGTTAGGTATTACTCGAGTAATACCTAACGCTTCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003325.3-3073s21c1
Sequence:CCGGTGAATACCGACTTCGAGAAATCTCGAGATTTCTCGAAGTCGGTATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003325.3-1203s21c1
Sequence:CCGGACAAATCCATCATGGATATTTCTCGAGAAATATCCATGATGGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)