EMAIL THIS PAGE TO A FRIEND

HIRIP3

HIRA interacting protein 3

70 Gene Product Result for
UniProtKB ID: Q9BW71, H3BSR3, O75707, O75708
Gene ID:
Human(8479) Summary: The HIRA protein shares sequence similarity with Hir1p and Hir2p, the two corepressors of histone gene transcription characterized in the yeast, Saccharomyces cerevisiae. The structural features of the HIRA protein suggest that it may function as part of a multiprotein complex. Several cDNAs encoding HIRA-interacting proteins, or HIRIPs, have been identified. In vitro, the protein encoded by this gene binds HIRA, as well as H2B and H3 core histones, indicating that a complex containing HIRA-HIRIP3 could function in some aspects of chromatin and histone metabolism. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Mouse(233876) HIRA interacting protein 3
Rat(361650) HIRA interacting protein 3
Zebrafish(100000570) HIRA interacting protein 3
domestic cat(101099766) HIRA interacting protein 3
cow(539704) HIRA interacting protein 3
Horse(100064047) HIRA interacting protein 3
dog(479786) HIRA interacting protein 3
domestic guinea pig(100731783) HIRA interacting protein 3
naked mole-rat(101705207) HIRA interacting protein 3
sheep(101117041) HIRA interacting protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003609 Rosetta Predictions human pricing
NM_001025725 Rosetta Predictions rat pricing
NM_172746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056803 predicted 1598
2 SASI_Hs01_00056804 predicted 2109
3 SASI_Hs01_00056805 predicted 1925
4 SASI_Hs01_00056806 predicted 1926
5 SASI_Hs01_00056807 predicted 479
6 SASI_Hs01_00056808 predicted 2082
7 SASI_Hs01_00056809 predicted 2077
8 SASI_Hs02_00335944 predicted 717
9 SASI_Hs01_00056810 predicted 740
10 SASI_Hs01_00056811 predicted 517
11 SASI_Hs01_00056812 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048299 predicted 740
2 SASI_Rn01_00048300 predicted 1418
3 SASI_Rn01_00048302 predicted 1924
4 SASI_Rn01_00048303 predicted 710
5 SASI_Rn01_00048304 predicted 1815
6 SASI_Rn01_00048305 predicted 1733
7 SASI_Rn01_00048306 predicted 1766
8 SASI_Rn01_00048307 predicted 783
9 SASI_Rn02_00203354 predicted 910
10 SASI_Rn02_00203355 predicted 1113
11 SASI_Rn01_00048301 predicted 617
12 SASI_Rn01_00048308 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119621 predicted 2128
2 SASI_Mm02_00344583 predicted 894
3 SASI_Mm01_00119622 predicted 830
4 SASI_Mm01_00119623 predicted 1044
5 SASI_Mm01_00119624 predicted 842
6 SASI_Mm01_00119625 predicted 870
7 SASI_Mm02_00344584 predicted 1258
8 SASI_Mm01_00119628 predicted 676
9 SASI_Mm01_00119629 predicted 2248
10 SASI_Mm02_00344585 predicted 1051
11 SASI_Mm01_00119626 predicted 1004
12 SASI_Mm01_00119627 predicted 2338
13 SASI_Mm01_00119630 predicted 2376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172746
VALIDATED
HIRIP3 MISSION shRNA Bacterial Glycerol Stock
HIRA interacting protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-955s21c1
Sequence:CCGGGGCTCTGTTAGATCAGGTAAGCTCGAGCTTACCTGATCTAACAGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172746.3-2330s21c1
Sequence:CCGGTGGTCAGTGGAAGCAACTTCCCTCGAGGGAAGTTGCTTCCACTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-1009s21c1
Sequence:CCGGCAGAAGGGCCAGGTTAGAAAGCTCGAGCTTTCTAACCTGGCCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-689s21c1
Sequence:CCGGGAAAGCCAGACTTTATCAAAGCTCGAGCTTTGATAAAGTCTGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-2229s21c1
Sequence:CCGGACCTCCAGACTGGTCCCATATCTCGAGATATGGGACCAGTCTGGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-1745s1c1
Sequence:CCGGCCCGAAGTTGTTCATCTTCATCTCGAGATGAAGATGAACAACTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-758s1c1
Sequence:CCGGGCTTTAATTCAGAGTCAGAATCTCGAGATTCTGACTCTGAATTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172746.2-815s1c1
Sequence:CCGGCCTCAACAAAGAACAGGACAACTCGAGTTGTCCTGTTCTTTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-1894s1c1
Sequence:CCGGGCTAGACTAAAGCGTTACATTCTCGAGAATGTAACGCTTTAGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172746
VALIDATED
HIRIP3 MISSION shRNA shRNA Plasmid DNA
HIRA interacting protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-955s21c1
Sequence:CCGGGGCTCTGTTAGATCAGGTAAGCTCGAGCTTACCTGATCTAACAGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172746.3-2330s21c1
Sequence:CCGGTGGTCAGTGGAAGCAACTTCCCTCGAGGGAAGTTGCTTCCACTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-1009s21c1
Sequence:CCGGCAGAAGGGCCAGGTTAGAAAGCTCGAGCTTTCTAACCTGGCCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-689s21c1
Sequence:CCGGGAAAGCCAGACTTTATCAAAGCTCGAGCTTTGATAAAGTCTGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-2229s21c1
Sequence:CCGGACCTCCAGACTGGTCCCATATCTCGAGATATGGGACCAGTCTGGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-1745s1c1
Sequence:CCGGCCCGAAGTTGTTCATCTTCATCTCGAGATGAAGATGAACAACTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-758s1c1
Sequence:CCGGGCTTTAATTCAGAGTCAGAATCTCGAGATTCTGACTCTGAATTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172746.2-815s1c1
Sequence:CCGGCCTCAACAAAGAACAGGACAACTCGAGTTGTCCTGTTCTTTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-1894s1c1
Sequence:CCGGGCTAGACTAAAGCGTTACATTCTCGAGAATGTAACGCTTTAGTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172746
VALIDATED
HIRIP3 MISSION shRNA Lentiviral Transduction Particles
HIRA interacting protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-955s21c1
Sequence:CCGGGGCTCTGTTAGATCAGGTAAGCTCGAGCTTACCTGATCTAACAGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172746.3-2330s21c1
Sequence:CCGGTGGTCAGTGGAAGCAACTTCCCTCGAGGGAAGTTGCTTCCACTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-1009s21c1
Sequence:CCGGCAGAAGGGCCAGGTTAGAAAGCTCGAGCTTTCTAACCTGGCCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-689s21c1
Sequence:CCGGGAAAGCCAGACTTTATCAAAGCTCGAGCTTTGATAAAGTCTGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172746.3-2229s21c1
Sequence:CCGGACCTCCAGACTGGTCCCATATCTCGAGATATGGGACCAGTCTGGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-1745s1c1
Sequence:CCGGCCCGAAGTTGTTCATCTTCATCTCGAGATGAAGATGAACAACTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-758s1c1
Sequence:CCGGGCTTTAATTCAGAGTCAGAATCTCGAGATTCTGACTCTGAATTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172746.2-815s1c1
Sequence:CCGGCCTCAACAAAGAACAGGACAACTCGAGTTGTCCTGTTCTTTGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172746.2-1894s1c1
Sequence:CCGGGCTAGACTAAAGCGTTACATTCTCGAGAATGTAACGCTTTAGTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003609
VALIDATED
HIRIP3 MISSION shRNA Bacterial Glycerol Stock
HIRA interacting protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-968s1c1
Sequence:CCGGGAAGACTAGGAAGAAACCTGTCTCGAGACAGGTTTCTTCCTAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1775s21c1
Sequence:CCGGCCATCGAAACTACAAGAAGCTCTCGAGAGCTTCTTGTAGTTTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1095s21c1
Sequence:CCGGGAGGGAAATAAAGGAACTAAACTCGAGTTTAGTTCCTTTATTTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-1775s1c1
Sequence:CCGGCCATCGAAACTACAAGAAGCTCTCGAGAGCTTCTTGTAGTTTCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-2153s1c1
Sequence:CCGGGACCCTTGATACATGTACAAACTCGAGTTTGTACATGTATCAAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-1160s1c1
Sequence:CCGGCCAGAAGAAAGAGCAGAGAGACTCGAGTCTCTCTGCTCTTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-2156s1c1
Sequence:CCGGCCTTGATACATGTACAAAGCACTCGAGTGCTTTGTACATGTATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1984s21c1
Sequence:CCGGGTACAGCCTGGAACCCTTTAGCTCGAGCTAAAGGGTTCCAGGCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-2153s21c1
Sequence:CCGGGACCCTTGATACATGTACAAACTCGAGTTTGTACATGTATCAAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-745s1c1
Sequence:CCGGGCTTCAATTCAGAGTCGGAGTCTCGAGACTCCGACTCTGAATTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003609
VALIDATED
HIRIP3 MISSION shRNA shRNA Plasmid DNA
HIRA interacting protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-968s1c1
Sequence:CCGGGAAGACTAGGAAGAAACCTGTCTCGAGACAGGTTTCTTCCTAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1775s21c1
Sequence:CCGGCCATCGAAACTACAAGAAGCTCTCGAGAGCTTCTTGTAGTTTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1095s21c1
Sequence:CCGGGAGGGAAATAAAGGAACTAAACTCGAGTTTAGTTCCTTTATTTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-1775s1c1
Sequence:CCGGCCATCGAAACTACAAGAAGCTCTCGAGAGCTTCTTGTAGTTTCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-2153s1c1
Sequence:CCGGGACCCTTGATACATGTACAAACTCGAGTTTGTACATGTATCAAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-1160s1c1
Sequence:CCGGCCAGAAGAAAGAGCAGAGAGACTCGAGTCTCTCTGCTCTTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-2156s1c1
Sequence:CCGGCCTTGATACATGTACAAAGCACTCGAGTGCTTTGTACATGTATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1984s21c1
Sequence:CCGGGTACAGCCTGGAACCCTTTAGCTCGAGCTAAAGGGTTCCAGGCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-2153s21c1
Sequence:CCGGGACCCTTGATACATGTACAAACTCGAGTTTGTACATGTATCAAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-745s1c1
Sequence:CCGGGCTTCAATTCAGAGTCGGAGTCTCGAGACTCCGACTCTGAATTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003609
VALIDATED
HIRIP3 MISSION shRNA Lentiviral Transduction Particles
HIRA interacting protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-968s1c1
Sequence:CCGGGAAGACTAGGAAGAAACCTGTCTCGAGACAGGTTTCTTCCTAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1775s21c1
Sequence:CCGGCCATCGAAACTACAAGAAGCTCTCGAGAGCTTCTTGTAGTTTCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1095s21c1
Sequence:CCGGGAGGGAAATAAAGGAACTAAACTCGAGTTTAGTTCCTTTATTTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-1775s1c1
Sequence:CCGGCCATCGAAACTACAAGAAGCTCTCGAGAGCTTCTTGTAGTTTCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-2153s1c1
Sequence:CCGGGACCCTTGATACATGTACAAACTCGAGTTTGTACATGTATCAAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-1160s1c1
Sequence:CCGGCCAGAAGAAAGAGCAGAGAGACTCGAGTCTCTCTGCTCTTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003609.2-2156s1c1
Sequence:CCGGCCTTGATACATGTACAAAGCACTCGAGTGCTTTGTACATGTATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-1984s21c1
Sequence:CCGGGTACAGCCTGGAACCCTTTAGCTCGAGCTAAAGGGTTCCAGGCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003609.2-2153s21c1
Sequence:CCGGGACCCTTGATACATGTACAAACTCGAGTTTGTACATGTATCAAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003609.2-745s1c1
Sequence:CCGGGCTTCAATTCAGAGTCGGAGTCTCGAGACTCCGACTCTGAATTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)