EMAIL THIS PAGE TO A FRIEND

HIST1H1A

histone cluster 1, H1a

46 Gene Product Result for
Synonyms: H1.1 H1A H1F1 HIST1
UniProtKB ID: Q02539, Q3MJ34
Gene ID:
Human(3024) Summary: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(80838) histone cluster 1, H1a
Rat(291145) histone cluster 1, H1a
cow(618164) histone cluster 1, H1a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0440 AQUA Peptide ALAAAGYDVE[K] human, mouse, rat pricing
AQ0441 AQUA Peptide GTGASGSF[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053241 MISSION® esiRNA esiRNA targeting mouse Hist1h1a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005325 Rosetta Predictions human pricing
NM_001106113 Rosetta Predictions rat pricing
NM_030609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015375 predicted 522
2 SASI_Hs01_00015376 predicted 327
3 SASI_Hs01_00015377 predicted 417
4 SASI_Hs01_00015378 predicted 243
5 SASI_Hs01_00015379 predicted 389
6 SASI_Hs01_00015380 predicted 375
7 SASI_Hs01_00015381 predicted 359
8 SASI_Hs01_00015382 predicted 417
9 SASI_Hs01_00015383 predicted 318
10 SASI_Hs01_00015384 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215752 predicted 292
2 SASI_Rn02_00215753 predicted 499
3 SASI_Rn02_00215754 predicted 498
4 SASI_Rn02_00215755 predicted 358
5 SASI_Rn02_00215756 predicted 221
6 SASI_Rn02_00215757 predicted 217
7 SASI_Rn02_00215758 predicted 409
8 SASI_Rn02_00215759 predicted 510
9 SASI_Rn02_00215760 predicted 513
10 SASI_Rn02_00215761 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123502 predicted 499
2 SASI_Mm01_00123503 predicted 223
3 SASI_Mm01_00123504 predicted 391
4 SASI_Mm01_00123505 predicted 434
5 SASI_Mm01_00123506 predicted 402
6 SASI_Mm01_00123507 predicted 220
7 SASI_Mm01_00123508 predicted 412
8 SASI_Mm01_00123510 predicted 508
9 SASI_Mm01_00123511 predicted 414
10 SASI_Mm02_00336801 predicted 504
11 SASI_Mm01_00123509 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005325
HIST1H1A MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1a
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-606s1c1
Sequence:CCGGCCTGCTAAAGCTAAGGCTGTACTCGAGTACAGCCTTAGCTTTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-298s1c1
Sequence:CCGGGCCGCATTAAGCTGGGCATTACTCGAGTAATGCCCAGCTTAATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-422s1c1
Sequence:CCGGCGCCTCAAAGGTGGCTACAAACTCGAGTTTGTAGCCACCTTTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-114s1c1
Sequence:CCGGGCTGGCAAGAAGGCAAAGAAACTCGAGTTTCTTTGCCTTCTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-104s1c1
Sequence:CCGGGAAACCTTTAGCTGGCAAGAACTCGAGTTCTTGCCAGCTAAAGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-553s21c1
Sequence:CCGGAGCCTGCGGCAACAAGGAAATCTCGAGATTTCCTTGTTGCCGCAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-258s21c1
Sequence:CCGGGTGTCGTTGGCAGCTCTTAAACTCGAGTTTAAGAGCTGCCAACGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-406s21c1
Sequence:CCGGAGCTCAACAAGAAGGCGTCCTCTCGAGAGGACGCCTTCTTGTTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-604s21c1
Sequence:CCGGTAAAGCCCAAGAAAGTAGCTACTCGAGTAGCTACTTTCTTGGGCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005325
HIST1H1A MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1a
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-606s1c1
Sequence:CCGGCCTGCTAAAGCTAAGGCTGTACTCGAGTACAGCCTTAGCTTTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-298s1c1
Sequence:CCGGGCCGCATTAAGCTGGGCATTACTCGAGTAATGCCCAGCTTAATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-422s1c1
Sequence:CCGGCGCCTCAAAGGTGGCTACAAACTCGAGTTTGTAGCCACCTTTGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-114s1c1
Sequence:CCGGGCTGGCAAGAAGGCAAAGAAACTCGAGTTTCTTTGCCTTCTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-104s1c1
Sequence:CCGGGAAACCTTTAGCTGGCAAGAACTCGAGTTCTTGCCAGCTAAAGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-553s21c1
Sequence:CCGGAGCCTGCGGCAACAAGGAAATCTCGAGATTTCCTTGTTGCCGCAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-258s21c1
Sequence:CCGGGTGTCGTTGGCAGCTCTTAAACTCGAGTTTAAGAGCTGCCAACGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-406s21c1
Sequence:CCGGAGCTCAACAAGAAGGCGTCCTCTCGAGAGGACGCCTTCTTGTTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-604s21c1
Sequence:CCGGTAAAGCCCAAGAAAGTAGCTACTCGAGTAGCTACTTTCTTGGGCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005325
HIST1H1A MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1a
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-606s1c1
Sequence:CCGGCCTGCTAAAGCTAAGGCTGTACTCGAGTACAGCCTTAGCTTTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-298s1c1
Sequence:CCGGGCCGCATTAAGCTGGGCATTACTCGAGTAATGCCCAGCTTAATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-422s1c1
Sequence:CCGGCGCCTCAAAGGTGGCTACAAACTCGAGTTTGTAGCCACCTTTGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-114s1c1
Sequence:CCGGGCTGGCAAGAAGGCAAAGAAACTCGAGTTTCTTTGCCTTCTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005325.2-104s1c1
Sequence:CCGGGAAACCTTTAGCTGGCAAGAACTCGAGTTCTTGCCAGCTAAAGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-553s21c1
Sequence:CCGGAGCCTGCGGCAACAAGGAAATCTCGAGATTTCCTTGTTGCCGCAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-258s21c1
Sequence:CCGGGTGTCGTTGGCAGCTCTTAAACTCGAGTTTAAGAGCTGCCAACGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-406s21c1
Sequence:CCGGAGCTCAACAAGAAGGCGTCCTCTCGAGAGGACGCCTTCTTGTTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005325.3-604s21c1
Sequence:CCGGTAAAGCCCAAGAAAGTAGCTACTCGAGTAGCTACTTTCTTGGGCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030609
HIST1H1A MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1a
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-481s1c1
Sequence:CCGGGAAGACTGTCAAGACTCCGAACTCGAGTTCGGAGTCTTGACAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-313s1c1
Sequence:CCGGCCTGGTGAATAAAGGCACACTCTCGAGAGTGTGCCTTTATTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-414s1c1
Sequence:CCGGTGTCAGTGAAGGCGAAAGCATCTCGAGATGCTTTCGCCTTCACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-190s1c1
Sequence:CCGGGCAGGCAGTTTCTTCTTCCAACTCGAGTTGGAAGAAGAAACTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-484s1c1
Sequence:CCGGGACTGTCAAGACTCCGAAGAACTCGAGTTCTTCGGAGTCTTGACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030609
HIST1H1A MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1a
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-481s1c1
Sequence:CCGGGAAGACTGTCAAGACTCCGAACTCGAGTTCGGAGTCTTGACAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-313s1c1
Sequence:CCGGCCTGGTGAATAAAGGCACACTCTCGAGAGTGTGCCTTTATTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-414s1c1
Sequence:CCGGTGTCAGTGAAGGCGAAAGCATCTCGAGATGCTTTCGCCTTCACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-190s1c1
Sequence:CCGGGCAGGCAGTTTCTTCTTCCAACTCGAGTTGGAAGAAGAAACTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-484s1c1
Sequence:CCGGGACTGTCAAGACTCCGAAGAACTCGAGTTCTTCGGAGTCTTGACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030609
HIST1H1A MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1a
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-481s1c1
Sequence:CCGGGAAGACTGTCAAGACTCCGAACTCGAGTTCGGAGTCTTGACAGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-313s1c1
Sequence:CCGGCCTGGTGAATAAAGGCACACTCTCGAGAGTGTGCCTTTATTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-414s1c1
Sequence:CCGGTGTCAGTGAAGGCGAAAGCATCTCGAGATGCTTTCGCCTTCACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-190s1c1
Sequence:CCGGGCAGGCAGTTTCTTCTTCCAACTCGAGTTGGAAGAAGAAACTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030609.1-484s1c1
Sequence:CCGGGACTGTCAAGACTCCGAAGAACTCGAGTTCTTCGGAGTCTTGACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)