EMAIL THIS PAGE TO A FRIEND

HIST1H1B

histone cluster 1, H1b

43 Gene Product Result for
Synonyms: H1 H1.5 H1B H1F5 H1s-3
UniProtKB ID: P16401, Q14529, Q3MJ42
Gene ID:
Human(3009) Summary: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(56702) histone cluster 1, H1b
Rat(680522) histone cluster 1, H1b
cow(527304) histone cluster 1, H1b
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303876 ANTI-HIST1H1B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4501366 Anti-Histone H1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504196 Anti-phospho-Histone H1 (pThr17) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0441 AQUA Peptide GTGASGSF[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005322 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147141 MISSION® esiRNA esiRNA human HIST1H1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005322 Rosetta Predictions human pricing
NM_001109417 Rosetta Predictions rat pricing
NM_020034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013531 predicted 287
2 SASI_Hs01_00013532 predicted 498
3 SASI_Hs01_00013533 predicted 415
4 SASI_Hs01_00013534 predicted 251
5 SASI_Hs01_00013535 predicted 218
6 SASI_Hs01_00013536 predicted 225
7 SASI_Hs01_00013537 predicted 512
8 SASI_Hs01_00013538 predicted 500
9 SASI_Hs01_00013539 predicted 198
10 SASI_Hs01_00013540 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248207 predicted 241
2 SASI_Rn02_00248208 predicted 267
3 SASI_Rn02_00248209 predicted 293
4 SASI_Rn02_00248210 predicted 262
5 SASI_Rn02_00248211 predicted 284
6 SASI_Rn02_00248212 predicted 232
7 SASI_Rn02_00248213 predicted 423
8 SASI_Rn02_00248214 predicted 231
9 SASI_Rn02_00248215 predicted 293
10 SASI_Rn02_00248216 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110111 predicted 428
2 SASI_Mm01_00110112 predicted 305
3 SASI_Mm01_00110113 predicted 228
4 SASI_Mm01_00110114 predicted 288
5 SASI_Mm01_00110115 predicted 301
6 SASI_Mm01_00110116 predicted 289
7 SASI_Mm01_00110117 predicted 227
8 SASI_Mm01_00110118 predicted 298
9 SASI_Mm01_00110119 predicted 297
10 SASI_Mm01_00110120 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005322
HIST1H1B MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1b
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-637s21c1
Sequence:CCGGAGTTAAGCCGAAGGCGGCAAACTCGAGTTTGCCGCCTTCGGCTTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-117s21c1
Sequence:CCGGAGAAGGCAACTAAGAAGGCTGCTCGAGCAGCCTTCTTAGTTGCCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-513s21c1
Sequence:CCGGAGACTCCGAAGAAGGCGAAGACTCGAGTCTTCGCCTTCTTCGGAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-107s1c1
Sequence:CCGGCCGGCTAAGAAGAAGGCAACTCTCGAGAGTTGCCTTCTTCTTAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-281s1c1
Sequence:CCGGGAGAAGAATAACAGCCGCATTCTCGAGAATGCGGCTGTTATTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-216s1c1
Sequence:CCGGAGGAGCGCAATGGCCTTTCTTCTCGAGAAGAAAGGCCATTGCGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-628s1c1
Sequence:CCGGGCCCAAGGCAGTTAAGCCGAACTCGAGTTCGGCTTAACTGCCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-503s1c1
Sequence:CCGGGCAGTGAAGAAGACTCCGAAGCTCGAGCTTCGGAGTCTTCTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005322
HIST1H1B MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1b
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-637s21c1
Sequence:CCGGAGTTAAGCCGAAGGCGGCAAACTCGAGTTTGCCGCCTTCGGCTTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-117s21c1
Sequence:CCGGAGAAGGCAACTAAGAAGGCTGCTCGAGCAGCCTTCTTAGTTGCCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-513s21c1
Sequence:CCGGAGACTCCGAAGAAGGCGAAGACTCGAGTCTTCGCCTTCTTCGGAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-107s1c1
Sequence:CCGGCCGGCTAAGAAGAAGGCAACTCTCGAGAGTTGCCTTCTTCTTAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-281s1c1
Sequence:CCGGGAGAAGAATAACAGCCGCATTCTCGAGAATGCGGCTGTTATTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-216s1c1
Sequence:CCGGAGGAGCGCAATGGCCTTTCTTCTCGAGAAGAAAGGCCATTGCGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-628s1c1
Sequence:CCGGGCCCAAGGCAGTTAAGCCGAACTCGAGTTCGGCTTAACTGCCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-503s1c1
Sequence:CCGGGCAGTGAAGAAGACTCCGAAGCTCGAGCTTCGGAGTCTTCTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005322
HIST1H1B MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1b
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-637s21c1
Sequence:CCGGAGTTAAGCCGAAGGCGGCAAACTCGAGTTTGCCGCCTTCGGCTTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-117s21c1
Sequence:CCGGAGAAGGCAACTAAGAAGGCTGCTCGAGCAGCCTTCTTAGTTGCCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005322.2-513s21c1
Sequence:CCGGAGACTCCGAAGAAGGCGAAGACTCGAGTCTTCGCCTTCTTCGGAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-107s1c1
Sequence:CCGGCCGGCTAAGAAGAAGGCAACTCTCGAGAGTTGCCTTCTTCTTAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-281s1c1
Sequence:CCGGGAGAAGAATAACAGCCGCATTCTCGAGAATGCGGCTGTTATTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-216s1c1
Sequence:CCGGAGGAGCGCAATGGCCTTTCTTCTCGAGAAGAAAGGCCATTGCGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-628s1c1
Sequence:CCGGGCCCAAGGCAGTTAAGCCGAACTCGAGTTCGGCTTAACTGCCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005322.2-503s1c1
Sequence:CCGGGCAGTGAAGAAGACTCCGAAGCTCGAGCTTCGGAGTCTTCTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020034
HIST1H1B MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-127s1c1
Sequence:CCGGCTCATCACTAAGGCTGTTTCTCTCGAGAGAAACAGCCTTAGTGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-303s1c1
Sequence:CCGGCTCTGGTTCCTTCAAGCTTAACTCGAGTTAAGCTTGAAGGAACCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-57s1c1
Sequence:CCGGCGCCAAGAAGAAGACAACGAACTCGAGTTCGTTGTCTTCTTCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-433s1c1
Sequence:CCGGGCAAAGAAGACCGTGAAGAAACTCGAGTTTCTTCACGGTCTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-134s1c1
Sequence:CCGGCTAAGGCTGTTTCTGCCTCTACTCGAGTAGAGGCAGAAACAGCCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020034
HIST1H1B MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-127s1c1
Sequence:CCGGCTCATCACTAAGGCTGTTTCTCTCGAGAGAAACAGCCTTAGTGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-303s1c1
Sequence:CCGGCTCTGGTTCCTTCAAGCTTAACTCGAGTTAAGCTTGAAGGAACCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-57s1c1
Sequence:CCGGCGCCAAGAAGAAGACAACGAACTCGAGTTCGTTGTCTTCTTCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-433s1c1
Sequence:CCGGGCAAAGAAGACCGTGAAGAAACTCGAGTTTCTTCACGGTCTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-134s1c1
Sequence:CCGGCTAAGGCTGTTTCTGCCTCTACTCGAGTAGAGGCAGAAACAGCCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020034
HIST1H1B MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-127s1c1
Sequence:CCGGCTCATCACTAAGGCTGTTTCTCTCGAGAGAAACAGCCTTAGTGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-303s1c1
Sequence:CCGGCTCTGGTTCCTTCAAGCTTAACTCGAGTTAAGCTTGAAGGAACCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-57s1c1
Sequence:CCGGCGCCAAGAAGAAGACAACGAACTCGAGTTCGTTGTCTTCTTCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-433s1c1
Sequence:CCGGGCAAAGAAGACCGTGAAGAAACTCGAGTTTCTTCACGGTCTTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020034.1-134s1c1
Sequence:CCGGCTAAGGCTGTTTCTGCCTCTACTCGAGTAGAGGCAGAAACAGCCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)