EMAIL THIS PAGE TO A FRIEND

HIST1H1C

histone cluster 1, H1c

42 Gene Product Result for
Synonyms: H1.2 H1C H1F2 H1s-1
UniProtKB ID: P16403, A8K4I2
Gene ID:
Human(3006) Summary: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(50708) histone cluster 1, H1c
cow(513971) histone cluster 1, H1c
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0440 AQUA Peptide ALAAAGYDVE[K] human, mouse, rat pricing
AQ0441 AQUA Peptide GTGASGSF[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005319 Rosetta Predictions human pricing
NM_015786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208704 predicted 309
2 SASI_Hs01_00208705 predicted 479
3 SASI_Hs01_00208706 predicted 246
4 SASI_Hs01_00208707 predicted 404
5 SASI_Hs01_00208708 predicted 480
6 SASI_Hs01_00208709 predicted 462
7 SASI_Hs01_00208710 predicted 274
8 SASI_Hs01_00208711 predicted 233
9 SASI_Hs01_00208712 predicted 467
10 SASI_Hs01_00208713 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056685 predicted 568
2 SASI_Mm01_00056686 predicted 723
3 SASI_Mm01_00056690 predicted 1063
4 SASI_Mm01_00056691 predicted 921
5 SASI_Mm01_00056692 predicted 1070
6 SASI_Mm01_00056693 predicted 1034
7 SASI_Mm01_00056694 predicted 932
8 SASI_Mm02_00323148 predicted 760
9 SASI_Mm02_00323149 predicted 587
10 SASI_Mm02_00323150 predicted 977
11 SASI_Mm01_00056687 predicted 657
12 SASI_Mm01_00056688 predicted 312
13 SASI_Mm01_00056689 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015786
VALIDATED
HIST1H1C MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1c
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-348s1c1
Sequence:CCGGCGGCTCCTTCAAACTCAACAACTCGAGTTGTTGAGTTTGAAGGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-615s1c1
Sequence:CCGGCGTAAAGCCAAAGGCTGCCAACTCGAGTTGGCAGCCTTTGGCTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-739s1c1
Sequence:CCGGGCTGTGACATTTGTGTGATTACTCGAGTAATCACACAAATGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-600s1c1
Sequence:CCGGGAGCGCGTCTAAAGCCGTAAACTCGAGTTTACGGCTTTAGACGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-537s1c1
Sequence:CCGGTGTGACCAAGAAAGTGGCCAACTCGAGTTGGCCACTTTCTTGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-309s21c1
Sequence:CCGGCAAGGGCATCCTGGTGCAAACCTCGAGGTTTGCACCAGGATGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-1148s21c1
Sequence:CCGGACGAACTGCCTTCCTTAATATCTCGAGATATTAAGGAAGGCAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-654s21c1
Sequence:CCGGCAAGAAGGTTGCAGCCAAGAACTCGAGTTCTTGGCTGCAACCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-563s21c1
Sequence:CCGGCAAAGAAGGCGAAGGTCACCACTCGAGTGGTGACCTTCGCCTTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-615s21c1
Sequence:CCGGCGTAAAGCCAAAGGCTGCCAACTCGAGTTGGCAGCCTTTGGCTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-934s21c1
Sequence:CCGGTATTGGACTGCAAGGTGATTTCTCGAGAAATCACCTTGCAGTCCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015786
VALIDATED
HIST1H1C MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1c
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-348s1c1
Sequence:CCGGCGGCTCCTTCAAACTCAACAACTCGAGTTGTTGAGTTTGAAGGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-615s1c1
Sequence:CCGGCGTAAAGCCAAAGGCTGCCAACTCGAGTTGGCAGCCTTTGGCTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-739s1c1
Sequence:CCGGGCTGTGACATTTGTGTGATTACTCGAGTAATCACACAAATGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-600s1c1
Sequence:CCGGGAGCGCGTCTAAAGCCGTAAACTCGAGTTTACGGCTTTAGACGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-537s1c1
Sequence:CCGGTGTGACCAAGAAAGTGGCCAACTCGAGTTGGCCACTTTCTTGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-309s21c1
Sequence:CCGGCAAGGGCATCCTGGTGCAAACCTCGAGGTTTGCACCAGGATGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-1148s21c1
Sequence:CCGGACGAACTGCCTTCCTTAATATCTCGAGATATTAAGGAAGGCAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-654s21c1
Sequence:CCGGCAAGAAGGTTGCAGCCAAGAACTCGAGTTCTTGGCTGCAACCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-563s21c1
Sequence:CCGGCAAAGAAGGCGAAGGTCACCACTCGAGTGGTGACCTTCGCCTTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-615s21c1
Sequence:CCGGCGTAAAGCCAAAGGCTGCCAACTCGAGTTGGCAGCCTTTGGCTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-934s21c1
Sequence:CCGGTATTGGACTGCAAGGTGATTTCTCGAGAAATCACCTTGCAGTCCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015786
VALIDATED
HIST1H1C MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1c
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-348s1c1
Sequence:CCGGCGGCTCCTTCAAACTCAACAACTCGAGTTGTTGAGTTTGAAGGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-615s1c1
Sequence:CCGGCGTAAAGCCAAAGGCTGCCAACTCGAGTTGGCAGCCTTTGGCTTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-739s1c1
Sequence:CCGGGCTGTGACATTTGTGTGATTACTCGAGTAATCACACAAATGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-600s1c1
Sequence:CCGGGAGCGCGTCTAAAGCCGTAAACTCGAGTTTACGGCTTTAGACGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015786.1-537s1c1
Sequence:CCGGTGTGACCAAGAAAGTGGCCAACTCGAGTTGGCCACTTTCTTGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-309s21c1
Sequence:CCGGCAAGGGCATCCTGGTGCAAACCTCGAGGTTTGCACCAGGATGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-1148s21c1
Sequence:CCGGACGAACTGCCTTCCTTAATATCTCGAGATATTAAGGAAGGCAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-654s21c1
Sequence:CCGGCAAGAAGGTTGCAGCCAAGAACTCGAGTTCTTGGCTGCAACCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-563s21c1
Sequence:CCGGCAAAGAAGGCGAAGGTCACCACTCGAGTGGTGACCTTCGCCTTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015786.1-615s21c1
Sequence:CCGGCGTAAAGCCAAAGGCTGCCAACTCGAGTTGGCAGCCTTTGGCTTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015786.1-934s21c1
Sequence:CCGGTATTGGACTGCAAGGTGATTTCTCGAGAAATCACCTTGCAGTCCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005319
HIST1H1C MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1c
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-482s1c1
Sequence:CCGGCCGAAGAAGAGCGCTAAGAAACTCGAGTTTCTTAGCGCTCTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-538s1c1
Sequence:CCGGTGTAACCAAGAAAGTGGCTAACTCGAGTTAGCCACTTTCTTGGTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-248s1c1
Sequence:CCGGGCCGGCTATGATGTGGAGAAACTCGAGTTTCTCCACATCATAGCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-191s1c1
Sequence:CCGGGCCTCTAAAGAGCGTAGCGGACTCGAGTCCGCTACGCTCTTTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-419s1c1
Sequence:CCGGACCAAACCTAAGAAGCCAGTTCTCGAGAACTGGCTTCTTAGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-315s21c1
Sequence:CCGGGCACTCTGGTGCAAACGAAAGCTCGAGCTTTCGTTTGCACCAGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-634s21c1
Sequence:CCGGCGCTAAGCCCAAGGTTGTCAACTCGAGTTGACAACCTTGGGCTTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-643s21c1
Sequence:CCGGCAAGGTTGTCAAGCCTAAGAACTCGAGTTCTTAGGCTTGACAACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-574s21c1
Sequence:CCGGCAAGGTTGCGAAGCCCAAGAACTCGAGTTCTTGGGCTTCGCAACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005319
HIST1H1C MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1c
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-482s1c1
Sequence:CCGGCCGAAGAAGAGCGCTAAGAAACTCGAGTTTCTTAGCGCTCTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-538s1c1
Sequence:CCGGTGTAACCAAGAAAGTGGCTAACTCGAGTTAGCCACTTTCTTGGTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-248s1c1
Sequence:CCGGGCCGGCTATGATGTGGAGAAACTCGAGTTTCTCCACATCATAGCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-191s1c1
Sequence:CCGGGCCTCTAAAGAGCGTAGCGGACTCGAGTCCGCTACGCTCTTTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-419s1c1
Sequence:CCGGACCAAACCTAAGAAGCCAGTTCTCGAGAACTGGCTTCTTAGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-315s21c1
Sequence:CCGGGCACTCTGGTGCAAACGAAAGCTCGAGCTTTCGTTTGCACCAGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-634s21c1
Sequence:CCGGCGCTAAGCCCAAGGTTGTCAACTCGAGTTGACAACCTTGGGCTTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-643s21c1
Sequence:CCGGCAAGGTTGTCAAGCCTAAGAACTCGAGTTCTTAGGCTTGACAACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-574s21c1
Sequence:CCGGCAAGGTTGCGAAGCCCAAGAACTCGAGTTCTTGGGCTTCGCAACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005319
HIST1H1C MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1c
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-482s1c1
Sequence:CCGGCCGAAGAAGAGCGCTAAGAAACTCGAGTTTCTTAGCGCTCTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-538s1c1
Sequence:CCGGTGTAACCAAGAAAGTGGCTAACTCGAGTTAGCCACTTTCTTGGTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-248s1c1
Sequence:CCGGGCCGGCTATGATGTGGAGAAACTCGAGTTTCTCCACATCATAGCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-191s1c1
Sequence:CCGGGCCTCTAAAGAGCGTAGCGGACTCGAGTCCGCTACGCTCTTTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005319.3-419s1c1
Sequence:CCGGACCAAACCTAAGAAGCCAGTTCTCGAGAACTGGCTTCTTAGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-315s21c1
Sequence:CCGGGCACTCTGGTGCAAACGAAAGCTCGAGCTTTCGTTTGCACCAGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-634s21c1
Sequence:CCGGCGCTAAGCCCAAGGTTGTCAACTCGAGTTGACAACCTTGGGCTTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-643s21c1
Sequence:CCGGCAAGGTTGTCAAGCCTAAGAACTCGAGTTCTTAGGCTTGACAACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005319.3-574s21c1
Sequence:CCGGCAAGGTTGCGAAGCCCAAGAACTCGAGTTCTTGGGCTTCGCAACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)