EMAIL THIS PAGE TO A FRIEND

HIST1H1D

histone cluster 1, H1d

54 Gene Product Result for
Synonyms: H1.3 H1D H1F3 H1s-2
UniProtKB ID: P16402, B2R751, Q2M2I2
Gene ID:
Human(3007) Summary: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(14957) histone cluster 1, H1d
Rat(201097) histone cluster 1, H1d
cow(509275) histone cluster 1, H1d
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302707 ANTI-HIST1H1D (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4504196 Anti-phospho-Histone H1 (pThr17) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0440 AQUA Peptide ALAAAGYDVE[K] human, mouse, rat pricing
AQ0441 AQUA Peptide GTGASGSF[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005320 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149861 MISSION® esiRNA esiRNA human HIST1H1D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005320 Rosetta Predictions human pricing
NM_133285 Rosetta Predictions rat pricing
NM_145713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232795 predicted 513
2 SASI_Hs01_00232796 predicted 283
3 SASI_Hs01_00232797 predicted 324
4 SASI_Hs01_00232798 predicted 219
5 SASI_Hs01_00232799 predicted 320
6 SASI_Hs01_00232800 predicted 215
7 SASI_Hs01_00232801 predicted 284
8 SASI_Hs01_00232802 predicted 287
9 SASI_Hs01_00232803 predicted 216
10 SASI_Hs01_00232804 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063739 predicted 201
2 SASI_Rn02_00267551 predicted 445
3 SASI_Rn02_00267552 predicted 36
4 SASI_Rn02_00267553 predicted 428
5 SASI_Rn02_00267554 predicted 404
6 SASI_Rn02_00267555 predicted 606
7 SASI_Rn02_00267556 predicted 613
8 SASI_Rn02_00267557 predicted 337
9 SASI_Rn02_00267558 predicted 33
10 SASI_Rn02_00267559 predicted 443
11 SASI_Rn01_00063733 predicted 237
12 SASI_Rn01_00063734 predicted 238
13 SASI_Rn01_00063735 predicted 209
14 SASI_Rn01_00063736 predicted 214
15 SASI_Rn01_00063737 predicted 205
16 SASI_Rn01_00063738 predicted 277
17 SASI_Rn01_00063740 predicted 274
18 SASI_Rn01_00063741 predicted 217
19 SASI_Rn01_00063742 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064422 predicted 866
2 SASI_Mm01_00064423 predicted 853
3 SASI_Mm01_00064424 predicted 1083
4 SASI_Mm01_00064425 predicted 1152
5 SASI_Mm01_00064426 predicted 809
6 SASI_Mm02_00341265 predicted 944
7 SASI_Mm01_00064427 predicted 838
8 SASI_Mm01_00064428 predicted 879
9 SASI_Mm01_00064429 predicted 640
10 SASI_Mm01_00064430 predicted 1189
11 SASI_Mm01_00064421 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145713
HIST1H1D MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1d
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145713.3-406s21c1
Sequence:CCGGGGCTAAGCCCAAGGCTAAGAACTCGAGTTCTTAGCCTTGGGCTTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-1032s21c1
Sequence:CCGGATGTCGCCTAGGCGTGATAAGCTCGAGCTTATCACGCCTAGGCGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-870s21c1
Sequence:CCGGCACTTTGTTATGGGTACATTTCTCGAGAAATGTACCCATAACAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-845s21c1
Sequence:CCGGTGTTCCGAAGCAGATCAATTCCTCGAGGAATTGATCTGCTTCGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145713.2-2419s1c1
Sequence:CCGGGCTCAATAAATACACAGGTAACTCGAGTTACCTGTGTATTTATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-556s1c1
Sequence:CCGGGCGCCAAGAAAGTTTCCAAGACTCGAGTCTTGGAAACTTTCTTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-648s1c1
Sequence:CCGGGCTAAGGCTTCCAAGCCTAAACTCGAGTTTAGGCTTGGAAGCCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-98s1c1
Sequence:CCGGTGTGGAGAAGACACCTGTGAACTCGAGTTCACAGGTGTCTTCTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-662s1c1
Sequence:CCGGGCCTAAAGCTTCTAAGCCGAACTCGAGTTCGGCTTAGAAGCTTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145713
HIST1H1D MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1d
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145713.3-406s21c1
Sequence:CCGGGGCTAAGCCCAAGGCTAAGAACTCGAGTTCTTAGCCTTGGGCTTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-1032s21c1
Sequence:CCGGATGTCGCCTAGGCGTGATAAGCTCGAGCTTATCACGCCTAGGCGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-870s21c1
Sequence:CCGGCACTTTGTTATGGGTACATTTCTCGAGAAATGTACCCATAACAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-845s21c1
Sequence:CCGGTGTTCCGAAGCAGATCAATTCCTCGAGGAATTGATCTGCTTCGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145713.2-2419s1c1
Sequence:CCGGGCTCAATAAATACACAGGTAACTCGAGTTACCTGTGTATTTATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-556s1c1
Sequence:CCGGGCGCCAAGAAAGTTTCCAAGACTCGAGTCTTGGAAACTTTCTTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-648s1c1
Sequence:CCGGGCTAAGGCTTCCAAGCCTAAACTCGAGTTTAGGCTTGGAAGCCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-98s1c1
Sequence:CCGGTGTGGAGAAGACACCTGTGAACTCGAGTTCACAGGTGTCTTCTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-662s1c1
Sequence:CCGGGCCTAAAGCTTCTAAGCCGAACTCGAGTTCGGCTTAGAAGCTTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145713
HIST1H1D MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1d
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145713.3-406s21c1
Sequence:CCGGGGCTAAGCCCAAGGCTAAGAACTCGAGTTCTTAGCCTTGGGCTTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-1032s21c1
Sequence:CCGGATGTCGCCTAGGCGTGATAAGCTCGAGCTTATCACGCCTAGGCGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-870s21c1
Sequence:CCGGCACTTTGTTATGGGTACATTTCTCGAGAAATGTACCCATAACAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145713.3-845s21c1
Sequence:CCGGTGTTCCGAAGCAGATCAATTCCTCGAGGAATTGATCTGCTTCGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145713.2-2419s1c1
Sequence:CCGGGCTCAATAAATACACAGGTAACTCGAGTTACCTGTGTATTTATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-556s1c1
Sequence:CCGGGCGCCAAGAAAGTTTCCAAGACTCGAGTCTTGGAAACTTTCTTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-648s1c1
Sequence:CCGGGCTAAGGCTTCCAAGCCTAAACTCGAGTTTAGGCTTGGAAGCCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-98s1c1
Sequence:CCGGTGTGGAGAAGACACCTGTGAACTCGAGTTCACAGGTGTCTTCTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145713.2-662s1c1
Sequence:CCGGGCCTAAAGCTTCTAAGCCGAACTCGAGTTCGGCTTAGAAGCTTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005320
VALIDATED
HIST1H1D MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1d
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-143s21c1
Sequence:CCGGACTGCTGGGAAACGCAAAGCACTCGAGTGCTTTGCGTTTCCCAGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-314s21c1
Sequence:CCGGAGCTTGGTGAGCAAAGGTACTCTCGAGAGTACCTTTGCTCACCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-176s21c1
Sequence:CCGGGTATCTGAGCTTATCACCAAGCTCGAGCTTGGTGATAAGCTCAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005320.2-84s1c1
Sequence:CCGGCCATTCCTGCACCCGCAGAAACTCGAGTTTCTGCGGGTGCAGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-521s1c1
Sequence:CCGGCCTAAGAAGGTAAAGAAGCCACTCGAGTGGCTTCTTTACCTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-324s1c1
Sequence:CCGGGCAAAGGTACTCTGGTGCAGACTCGAGTCTGCACCAGAGTACCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005320.2-367s1c1
Sequence:CCGGCTCCTTCAAACTCAACAAGAACTCGAGTTCTTGTTGAGTTTGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-134s1c1
Sequence:CCGGGCAGGCGCAACTGCTGGGAAACTCGAGTTTCCCAGCAGTTGCGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-562s21c1
Sequence:CCGGGAAAGTGGCCAAGAGTGCGAACTCGAGTTCGCACTCTTGGCCACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005320
VALIDATED
HIST1H1D MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1d
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-143s21c1
Sequence:CCGGACTGCTGGGAAACGCAAAGCACTCGAGTGCTTTGCGTTTCCCAGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-314s21c1
Sequence:CCGGAGCTTGGTGAGCAAAGGTACTCTCGAGAGTACCTTTGCTCACCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-176s21c1
Sequence:CCGGGTATCTGAGCTTATCACCAAGCTCGAGCTTGGTGATAAGCTCAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005320.2-84s1c1
Sequence:CCGGCCATTCCTGCACCCGCAGAAACTCGAGTTTCTGCGGGTGCAGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-521s1c1
Sequence:CCGGCCTAAGAAGGTAAAGAAGCCACTCGAGTGGCTTCTTTACCTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-324s1c1
Sequence:CCGGGCAAAGGTACTCTGGTGCAGACTCGAGTCTGCACCAGAGTACCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005320.2-367s1c1
Sequence:CCGGCTCCTTCAAACTCAACAAGAACTCGAGTTCTTGTTGAGTTTGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-134s1c1
Sequence:CCGGGCAGGCGCAACTGCTGGGAAACTCGAGTTTCCCAGCAGTTGCGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-562s21c1
Sequence:CCGGGAAAGTGGCCAAGAGTGCGAACTCGAGTTCGCACTCTTGGCCACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005320
VALIDATED
HIST1H1D MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1d
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-143s21c1
Sequence:CCGGACTGCTGGGAAACGCAAAGCACTCGAGTGCTTTGCGTTTCCCAGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-314s21c1
Sequence:CCGGAGCTTGGTGAGCAAAGGTACTCTCGAGAGTACCTTTGCTCACCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-176s21c1
Sequence:CCGGGTATCTGAGCTTATCACCAAGCTCGAGCTTGGTGATAAGCTCAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005320.2-84s1c1
Sequence:CCGGCCATTCCTGCACCCGCAGAAACTCGAGTTTCTGCGGGTGCAGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-521s1c1
Sequence:CCGGCCTAAGAAGGTAAAGAAGCCACTCGAGTGGCTTCTTTACCTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-324s1c1
Sequence:CCGGGCAAAGGTACTCTGGTGCAGACTCGAGTCTGCACCAGAGTACCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005320.2-367s1c1
Sequence:CCGGCTCCTTCAAACTCAACAAGAACTCGAGTTCTTGTTGAGTTTGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005320.2-134s1c1
Sequence:CCGGGCAGGCGCAACTGCTGGGAAACTCGAGTTTCCCAGCAGTTGCGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005320.2-562s21c1
Sequence:CCGGGAAAGTGGCCAAGAGTGCGAACTCGAGTTCGCACTCTTGGCCACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)