EMAIL THIS PAGE TO A FRIEND

HIST1H1E

histone cluster 1, H1e

33 Gene Product Result for
Synonyms: H1.4 H1E H1F4 H1s-4 dJ221C16.5
UniProtKB ID: P10412, Q4VB25
Gene ID:
Human(3008) Summary: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(50709) histone cluster 1, H1e
cow(515957) histone cluster 1, H1e
cow(617854) histone cluster 1, H1e
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0440 AQUA Peptide ALAAAGYDVE[K] human, mouse, rat pricing
AQ0441 AQUA Peptide GTGASGSF[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005321 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038891 MISSION® esiRNA esiRNA human HIST1H1E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005321 Rosetta Predictions human pricing
NM_015787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211758 predicted 290
2 SASI_Hs01_00211759 predicted 226
3 SASI_Hs01_00211760 predicted 216
4 SASI_Hs01_00211761 predicted 223
5 SASI_Hs01_00211762 predicted 292
6 SASI_Hs01_00211763 predicted 218
7 SASI_Hs01_00211764 predicted 255
8 SASI_Hs01_00211765 predicted 260
9 SASI_Hs01_00211766 predicted 207
10 SASI_Hs01_00211767 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130152 predicted 640
2 SASI_Mm01_00130153 predicted 871
3 SASI_Mm01_00130154 predicted 836
4 SASI_Mm01_00130155 predicted 580
5 SASI_Mm01_00130156 predicted 748
6 SASI_Mm01_00130157 predicted 913
7 SASI_Mm01_00130158 predicted 584
8 SASI_Mm01_00130159 predicted 819
9 SASI_Mm01_00130160 predicted 676
10 SASI_Mm01_00130161 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015787
HIST1H1E MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1e
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-641s1c1
Sequence:CCGGGTAAAGCCTAAAGCGGCCAAACTCGAGTTTGGCCGCTTTAGGCTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015787.2-1401s1c1
Sequence:CCGGCCTCATTTGAATACTGCGTAACTCGAGTTACGCAGTATTCAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-588s1c1
Sequence:CCGGCAAAGGCAACTAAGGCTAAGACTCGAGTCTTAGCCTTAGTTGCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-103s1c1
Sequence:CCGGCGCCGAGAAGACACCCGTCAACTCGAGTTGACGGGTGTCTTCTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-669s1c1
Sequence:CCGGCCTCCAAGCCTAAGGCAGCTACTCGAGTAGCTGCCTTAGGCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015787
HIST1H1E MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1e
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-641s1c1
Sequence:CCGGGTAAAGCCTAAAGCGGCCAAACTCGAGTTTGGCCGCTTTAGGCTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015787.2-1401s1c1
Sequence:CCGGCCTCATTTGAATACTGCGTAACTCGAGTTACGCAGTATTCAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-588s1c1
Sequence:CCGGCAAAGGCAACTAAGGCTAAGACTCGAGTCTTAGCCTTAGTTGCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-103s1c1
Sequence:CCGGCGCCGAGAAGACACCCGTCAACTCGAGTTGACGGGTGTCTTCTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-669s1c1
Sequence:CCGGCCTCCAAGCCTAAGGCAGCTACTCGAGTAGCTGCCTTAGGCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015787
HIST1H1E MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1e
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-641s1c1
Sequence:CCGGGTAAAGCCTAAAGCGGCCAAACTCGAGTTTGGCCGCTTTAGGCTTTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015787.2-1401s1c1
Sequence:CCGGCCTCATTTGAATACTGCGTAACTCGAGTTACGCAGTATTCAAATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-588s1c1
Sequence:CCGGCAAAGGCAACTAAGGCTAAGACTCGAGTCTTAGCCTTAGTTGCCTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-103s1c1
Sequence:CCGGCGCCGAGAAGACACCCGTCAACTCGAGTTGACGGGTGTCTTCTCGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015787.2-669s1c1
Sequence:CCGGCCTCCAAGCCTAAGGCAGCTACTCGAGTAGCTGCCTTAGGCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005321
VALIDATED
HIST1H1E MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1e
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-625s1c1
Sequence:CCGGGCGAAGGCCAAAGCAGTTAAACTCGAGTTTAACTGCTTTGGCCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-228s1c1
Sequence:CCGGCGTATCTTTGGCCGCTCTCAACTCGAGTTGAGAGCGGCCAAAGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-360s1c1
Sequence:CCGGCGCGTCGGGTTCCTTCAAACTCTCGAGAGTTTGAAGGAACCCGACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-105s1c1
Sequence:CCGGCGAGAAGACTCCCGTGAAGAACTCGAGTTCTTCACGGGAGTCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-184s1c1
Sequence:CCGGGAGCTCATTACTAAAGCTGTTCTCGAGAACAGCTTTAGTAATGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-106s21c1
Sequence:CCGGGAGAAGACTCCCGTGAAGAAGCTCGAGCTTCTTCACGGGAGTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-403s21c1
Sequence:CCGGGAAGCCAAGCCTAAGGCTAAACTCGAGTTTAGCCTTAGGCTTGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005321.2-282s21c1
Sequence:CCGGGAAGAACAACAGCCGCATCAACTCGAGTTGATGCGGCTGTTGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-233s21c1
Sequence:CCGGCTTTGGCCGCTCTCAAGAAAGCTCGAGCTTTCTTGAGAGCGGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-178s21c1
Sequence:CCGGGTGTCCGAGCTCATTACTAAACTCGAGTTTAGTAATGAGCTCGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-585s21c1
Sequence:CCGGGGCGAAAGCAGCCAAGCCAAACTCGAGTTTGGCTTGGCTGCTTTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-500s21c1
Sequence:CCGGCCAAGAAGAGCGCCAAGAAGACTCGAGTCTTCTTGGCGCTCTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005321
VALIDATED
HIST1H1E MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1e
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-625s1c1
Sequence:CCGGGCGAAGGCCAAAGCAGTTAAACTCGAGTTTAACTGCTTTGGCCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-228s1c1
Sequence:CCGGCGTATCTTTGGCCGCTCTCAACTCGAGTTGAGAGCGGCCAAAGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-360s1c1
Sequence:CCGGCGCGTCGGGTTCCTTCAAACTCTCGAGAGTTTGAAGGAACCCGACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-105s1c1
Sequence:CCGGCGAGAAGACTCCCGTGAAGAACTCGAGTTCTTCACGGGAGTCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-184s1c1
Sequence:CCGGGAGCTCATTACTAAAGCTGTTCTCGAGAACAGCTTTAGTAATGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-106s21c1
Sequence:CCGGGAGAAGACTCCCGTGAAGAAGCTCGAGCTTCTTCACGGGAGTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-403s21c1
Sequence:CCGGGAAGCCAAGCCTAAGGCTAAACTCGAGTTTAGCCTTAGGCTTGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005321.2-282s21c1
Sequence:CCGGGAAGAACAACAGCCGCATCAACTCGAGTTGATGCGGCTGTTGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-233s21c1
Sequence:CCGGCTTTGGCCGCTCTCAAGAAAGCTCGAGCTTTCTTGAGAGCGGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-178s21c1
Sequence:CCGGGTGTCCGAGCTCATTACTAAACTCGAGTTTAGTAATGAGCTCGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-585s21c1
Sequence:CCGGGGCGAAAGCAGCCAAGCCAAACTCGAGTTTGGCTTGGCTGCTTTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-500s21c1
Sequence:CCGGCCAAGAAGAGCGCCAAGAAGACTCGAGTCTTCTTGGCGCTCTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005321
VALIDATED
HIST1H1E MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1e
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-625s1c1
Sequence:CCGGGCGAAGGCCAAAGCAGTTAAACTCGAGTTTAACTGCTTTGGCCTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-228s1c1
Sequence:CCGGCGTATCTTTGGCCGCTCTCAACTCGAGTTGAGAGCGGCCAAAGATACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-360s1c1
Sequence:CCGGCGCGTCGGGTTCCTTCAAACTCTCGAGAGTTTGAAGGAACCCGACGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-105s1c1
Sequence:CCGGCGAGAAGACTCCCGTGAAGAACTCGAGTTCTTCACGGGAGTCTTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005321.2-184s1c1
Sequence:CCGGGAGCTCATTACTAAAGCTGTTCTCGAGAACAGCTTTAGTAATGAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-106s21c1
Sequence:CCGGGAGAAGACTCCCGTGAAGAAGCTCGAGCTTCTTCACGGGAGTCTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-403s21c1
Sequence:CCGGGAAGCCAAGCCTAAGGCTAAACTCGAGTTTAGCCTTAGGCTTGGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005321.2-282s21c1
Sequence:CCGGGAAGAACAACAGCCGCATCAACTCGAGTTGATGCGGCTGTTGTTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-233s21c1
Sequence:CCGGCTTTGGCCGCTCTCAAGAAAGCTCGAGCTTTCTTGAGAGCGGCCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-178s21c1
Sequence:CCGGGTGTCCGAGCTCATTACTAAACTCGAGTTTAGTAATGAGCTCGGACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-585s21c1
Sequence:CCGGGGCGAAAGCAGCCAAGCCAAACTCGAGTTTGGCTTGGCTGCTTTCGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005321.2-500s21c1
Sequence:CCGGCCAAGAAGAGCGCCAAGAAGACTCGAGTCTTCTTGGCGCTCTTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)