EMAIL THIS PAGE TO A FRIEND

HIST1H1T

histone cluster 1, H1t

57 Gene Product Result for
Synonyms: H1FT H1t dJ221C16.2
UniProtKB ID: P22492, Q6ISI1, Q8IUE8
Gene ID:
Human(3010) Summary: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(107970) histone cluster 1, H1t
Rat(24438) histone cluster 1, H1t
dog(488266) histone cluster 1, H1t
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0440 AQUA Peptide ALAAAGYDVE[K] human, mouse, rat pricing
AQ0441 AQUA Peptide GTGASGSF[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020251 MISSION® esiRNA esiRNA human HIST1H1T (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005323 Rosetta Predictions human pricing
NM_012579 Rosetta Predictions rat pricing
NM_010377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174786 predicted 302
2 SASI_Hs01_00174787 predicted 213
3 SASI_Hs02_00339389 predicted 283
4 SASI_Hs01_00174788 predicted 390
5 SASI_Hs02_00339390 predicted 355
6 SASI_Hs01_00174789 predicted 364
7 SASI_Hs01_00174790 predicted 385
8 SASI_Hs01_00174791 predicted 210
9 SASI_Hs01_00174793 predicted 462
10 SASI_Hs01_00174794 predicted 371
11 SASI_Hs01_00174792 predicted 211
12 SASI_Hs01_00174795 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110959 predicted 320
2 SASI_Rn01_00110960 predicted 319
3 SASI_Rn01_00110961 predicted 403
4 SASI_Rn01_00110962 predicted 315
5 SASI_Rn01_00110963 predicted 304
6 SASI_Rn01_00110965 predicted 301
7 SASI_Rn01_00110966 predicted 329
8 SASI_Rn01_00110967 predicted 345
9 SASI_Rn01_00110968 predicted 307
10 SASI_Rn02_00259713 predicted 232
11 SASI_Rn01_00110964 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318443 predicted 291
2 SASI_Mm01_00094452 predicted 372
3 SASI_Mm02_00318444 predicted 293
4 SASI_Mm01_00094458 predicted 327
5 SASI_Mm02_00318445 predicted 512
6 SASI_Mm02_00318446 predicted 674
7 SASI_Mm02_00318447 predicted 669
8 SASI_Mm02_00318448 predicted 474
9 SASI_Mm02_00318449 predicted 462
10 SASI_Mm02_00318450 predicted 507
11 SASI_Mm01_00094453 predicted 302
12 SASI_Mm01_00094454 predicted 294
13 SASI_Mm01_00094455 predicted 367
14 SASI_Mm01_00094456 predicted 304
15 SASI_Mm01_00094457 predicted 313
16 SASI_Mm01_00094459 predicted 312
17 SASI_Mm01_00094460 predicted 369
18 SASI_Mm01_00094461 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005323
HIST1H1T MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1t
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-594s21c1
Sequence:CCGGAGGCAAGGGCTTCGAAGTCAACTCGAGTTGACTTCGAAGCCCTTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-629s21c1
Sequence:CCGGCATGAAGTTAATGTTAGAAAGCTCGAGCTTTCTAACATTAACTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-81s21c1
Sequence:CCGGGTGTAGCCGCTATGGAGAAACCTCGAGGTTTCTCCATAGCGGCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-361s1c1
Sequence:CCGGCGGTTCCTTTAAGCTTAGTAACTCGAGTTACTAAGCTTAAAGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-205s1c1
Sequence:CCGGGTCACAGGAACGAGTAGGTATCTCGAGATACCTACTCGTTCCTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-310s1c1
Sequence:CCGGGAGCTTAGTGAACAAGGGAATCTCGAGATTCCCTTGTTCACTAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-131s1c1
Sequence:CCGGGCTGGCTTGATAAGTGCAAGTCTCGAGACTTGCACTTATCAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-215s1c1
Sequence:CCGGCGAGTAGGTATGTCTTTGGTTCTCGAGAACCAAAGACATACCTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005323
HIST1H1T MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1t
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-594s21c1
Sequence:CCGGAGGCAAGGGCTTCGAAGTCAACTCGAGTTGACTTCGAAGCCCTTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-629s21c1
Sequence:CCGGCATGAAGTTAATGTTAGAAAGCTCGAGCTTTCTAACATTAACTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-81s21c1
Sequence:CCGGGTGTAGCCGCTATGGAGAAACCTCGAGGTTTCTCCATAGCGGCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-361s1c1
Sequence:CCGGCGGTTCCTTTAAGCTTAGTAACTCGAGTTACTAAGCTTAAAGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-205s1c1
Sequence:CCGGGTCACAGGAACGAGTAGGTATCTCGAGATACCTACTCGTTCCTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-310s1c1
Sequence:CCGGGAGCTTAGTGAACAAGGGAATCTCGAGATTCCCTTGTTCACTAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-131s1c1
Sequence:CCGGGCTGGCTTGATAAGTGCAAGTCTCGAGACTTGCACTTATCAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-215s1c1
Sequence:CCGGCGAGTAGGTATGTCTTTGGTTCTCGAGAACCAAAGACATACCTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005323
HIST1H1T MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1t
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-594s21c1
Sequence:CCGGAGGCAAGGGCTTCGAAGTCAACTCGAGTTGACTTCGAAGCCCTTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-629s21c1
Sequence:CCGGCATGAAGTTAATGTTAGAAAGCTCGAGCTTTCTAACATTAACTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005323.3-81s21c1
Sequence:CCGGGTGTAGCCGCTATGGAGAAACCTCGAGGTTTCTCCATAGCGGCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-361s1c1
Sequence:CCGGCGGTTCCTTTAAGCTTAGTAACTCGAGTTACTAAGCTTAAAGGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-205s1c1
Sequence:CCGGGTCACAGGAACGAGTAGGTATCTCGAGATACCTACTCGTTCCTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-310s1c1
Sequence:CCGGGAGCTTAGTGAACAAGGGAATCTCGAGATTCCCTTGTTCACTAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-131s1c1
Sequence:CCGGGCTGGCTTGATAAGTGCAAGTCTCGAGACTTGCACTTATCAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005323.3-215s1c1
Sequence:CCGGCGAGTAGGTATGTCTTTGGTTCTCGAGAACCAAAGACATACCTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010377
HIST1H1T MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H1t
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-309s1c1
Sequence:CCGGCCCTCAAGAGACTTGTGAATACTCGAGTATTCACAAGTCTCTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-102s1c1
Sequence:CCGGCTGTGGAGAAACCTTCATCTACTCGAGTAGATGAAGGTTTCTCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-511s1c1
Sequence:CCGGGCCAAAGGCTACGCCCACAAACTCGAGTTTGTGGGCGTAGCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-311s1c1
Sequence:CCGGCTCAAGAGACTTGTGAATAAACTCGAGTTTATTCACAAGTCTCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-414s1c1
Sequence:CCGGGCAAGGGCAAGAAATCTGCTTCTCGAGAAGCAGATTTCTTGCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010377
HIST1H1T MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H1t
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-309s1c1
Sequence:CCGGCCCTCAAGAGACTTGTGAATACTCGAGTATTCACAAGTCTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-102s1c1
Sequence:CCGGCTGTGGAGAAACCTTCATCTACTCGAGTAGATGAAGGTTTCTCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-511s1c1
Sequence:CCGGGCCAAAGGCTACGCCCACAAACTCGAGTTTGTGGGCGTAGCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-311s1c1
Sequence:CCGGCTCAAGAGACTTGTGAATAAACTCGAGTTTATTCACAAGTCTCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-414s1c1
Sequence:CCGGGCAAGGGCAAGAAATCTGCTTCTCGAGAAGCAGATTTCTTGCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010377
HIST1H1T MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H1t
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-309s1c1
Sequence:CCGGCCCTCAAGAGACTTGTGAATACTCGAGTATTCACAAGTCTCTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-102s1c1
Sequence:CCGGCTGTGGAGAAACCTTCATCTACTCGAGTAGATGAAGGTTTCTCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-511s1c1
Sequence:CCGGGCCAAAGGCTACGCCCACAAACTCGAGTTTGTGGGCGTAGCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-311s1c1
Sequence:CCGGCTCAAGAGACTTGTGAATAAACTCGAGTTTATTCACAAGTCTCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010377.1-414s1c1
Sequence:CCGGGCAAGGGCAAGAAATCTGCTTCTCGAGAAGCAGATTTCTTGCCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)