EMAIL THIS PAGE TO A FRIEND

HIST1H2AA

histone cluster 1, H2aa

42 Gene Product Result for
Synonyms: H2AA H2AFR bA317E16.2
UniProtKB ID: Q96QV6
Gene ID:
Human(221613) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Jul 2008]
Mouse(319163) histone cluster 1, H2aa
Rat(24828) histone cluster 1, H2aa
cow(787441) histone cluster 1, H2aa
dog(488251) histone cluster 1, H2aa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302081 ANTI-HIST1H2AA (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170745 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU215971 MISSION® esiRNA esiRNA targeting mouse Hist1h2aa mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170745 Rosetta Predictions human pricing
NM_021839 Rosetta Predictions rat pricing
NM_175658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064700 predicted 236
2 SASI_Hs01_00064701 predicted 234
3 SASI_Hs01_00064702 predicted 198
4 SASI_Hs01_00064703 predicted 238
5 SASI_Hs01_00064704 predicted 231
6 SASI_Hs01_00064705 predicted 237
7 SASI_Hs01_00064707 predicted 230
8 SASI_Hs01_00064708 predicted 200
9 SASI_Hs01_00064709 predicted 227
10 SASI_Hs02_00367711 predicted 297
11 SASI_Hs01_00064706 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067731 predicted 195
2 SASI_Rn01_00067732 predicted 45
3 SASI_Rn01_00067733 predicted 51
4 SASI_Rn01_00067734 predicted 198
5 SASI_Rn01_00067735 predicted 43
6 SASI_Rn01_00067736 predicted 44
7 SASI_Rn01_00067737 predicted 33
8 SASI_Rn01_00067738 predicted 106
9 SASI_Rn01_00067739 predicted 41
10 SASI_Rn02_00262849 predicted 98
11 SASI_Rn01_00067740 predicted 112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199401 predicted 90
2 SASI_Mm01_00199402 predicted 109
3 SASI_Mm01_00199403 predicted 110
4 SASI_Mm01_00199404 predicted 230
5 SASI_Mm01_00199405 predicted 175
6 SASI_Mm01_00199406 predicted 141
7 SASI_Mm01_00199407 predicted 136
8 SASI_Mm01_00199408 predicted 23
9 SASI_Mm01_00199409 predicted 92
10 SASI_Mm01_00199410 predicted 157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175658
HIST1H2AA MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2aa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-160s1c1
Sequence:CCGGGCAGTGCTAGAATACTTGACACTCGAGTGTCAAGTATTCTAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-106s1c1
Sequence:CCGGCGCCAAGGGAACTACGCACAACTCGAGTTGTGCGTAGTTCCCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-231s1c1
Sequence:CCGGGCGCATTACTCCTCGCCACCTCTCGAGAGGTGGCGAGGAGTAATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-165s1c1
Sequence:CCGGGCTAGAATACTTGACAGCTGACTCGAGTCAGCTGTCAAGTATTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-31s1c1
Sequence:CCGGGCTCGTGCCAAGGTCAAGTCTCTCGAGAGACTTGACCTTGGCACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175658
HIST1H2AA MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2aa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-160s1c1
Sequence:CCGGGCAGTGCTAGAATACTTGACACTCGAGTGTCAAGTATTCTAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-106s1c1
Sequence:CCGGCGCCAAGGGAACTACGCACAACTCGAGTTGTGCGTAGTTCCCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-231s1c1
Sequence:CCGGGCGCATTACTCCTCGCCACCTCTCGAGAGGTGGCGAGGAGTAATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-165s1c1
Sequence:CCGGGCTAGAATACTTGACAGCTGACTCGAGTCAGCTGTCAAGTATTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-31s1c1
Sequence:CCGGGCTCGTGCCAAGGTCAAGTCTCTCGAGAGACTTGACCTTGGCACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175658
HIST1H2AA MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2aa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-160s1c1
Sequence:CCGGGCAGTGCTAGAATACTTGACACTCGAGTGTCAAGTATTCTAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-106s1c1
Sequence:CCGGCGCCAAGGGAACTACGCACAACTCGAGTTGTGCGTAGTTCCCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-231s1c1
Sequence:CCGGGCGCATTACTCCTCGCCACCTCTCGAGAGGTGGCGAGGAGTAATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-165s1c1
Sequence:CCGGGCTAGAATACTTGACAGCTGACTCGAGTCAGCTGTCAAGTATTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175658.1-31s1c1
Sequence:CCGGGCTCGTGCCAAGGTCAAGTCTCTCGAGAGACTTGACCTTGGCACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170745
HIST1H2AA MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2aa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-300s1c1
Sequence:CCGGCGCAATGATGAGGAACTCAATCTCGAGATTGAGTTCCTCATCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-239s1c1
Sequence:CCGGCAATGCGTCTCGCGATAACAACTCGAGTTGTTATCGCGAGACGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-99s1c1
Sequence:CCGGGCGGGTTTGCAGTTTCCCGTACTCGAGTACGGGAAACTGCAAACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-73s1c1
Sequence:CCGGCCAAGTCTAAGTCTCGCTCTTCTCGAGAAGAGCGAGACTTAGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-135s1c1
Sequence:CCGGCTGCTTCGTAAGGGAAACTATCTCGAGATAGTTTCCCTTACGAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-171s21c1
Sequence:CCGGGCAGGCGCACCAGTGTATTTGCTCGAGCAAATACACTGGTGCGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-289s21c1
Sequence:CCGGAGCTAGCGATCCGCAATGATGCTCGAGCATCATTGCGGATCGCTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-148s21c1
Sequence:CCGGGAAACTATGCAGAGCGGATAGCTCGAGCTATCCGCTCTGCATAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170745
HIST1H2AA MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2aa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-300s1c1
Sequence:CCGGCGCAATGATGAGGAACTCAATCTCGAGATTGAGTTCCTCATCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-239s1c1
Sequence:CCGGCAATGCGTCTCGCGATAACAACTCGAGTTGTTATCGCGAGACGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-99s1c1
Sequence:CCGGGCGGGTTTGCAGTTTCCCGTACTCGAGTACGGGAAACTGCAAACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-73s1c1
Sequence:CCGGCCAAGTCTAAGTCTCGCTCTTCTCGAGAAGAGCGAGACTTAGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-135s1c1
Sequence:CCGGCTGCTTCGTAAGGGAAACTATCTCGAGATAGTTTCCCTTACGAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-171s21c1
Sequence:CCGGGCAGGCGCACCAGTGTATTTGCTCGAGCAAATACACTGGTGCGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-289s21c1
Sequence:CCGGAGCTAGCGATCCGCAATGATGCTCGAGCATCATTGCGGATCGCTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-148s21c1
Sequence:CCGGGAAACTATGCAGAGCGGATAGCTCGAGCTATCCGCTCTGCATAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170745
HIST1H2AA MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2aa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-300s1c1
Sequence:CCGGCGCAATGATGAGGAACTCAATCTCGAGATTGAGTTCCTCATCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-239s1c1
Sequence:CCGGCAATGCGTCTCGCGATAACAACTCGAGTTGTTATCGCGAGACGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-99s1c1
Sequence:CCGGGCGGGTTTGCAGTTTCCCGTACTCGAGTACGGGAAACTGCAAACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-73s1c1
Sequence:CCGGCCAAGTCTAAGTCTCGCTCTTCTCGAGAAGAGCGAGACTTAGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170745.3-135s1c1
Sequence:CCGGCTGCTTCGTAAGGGAAACTATCTCGAGATAGTTTCCCTTACGAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-171s21c1
Sequence:CCGGGCAGGCGCACCAGTGTATTTGCTCGAGCAAATACACTGGTGCGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-289s21c1
Sequence:CCGGAGCTAGCGATCCGCAATGATGCTCGAGCATCATTGCGGATCGCTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170745.3-148s21c1
Sequence:CCGGGAAACTATGCAGAGCGGATAGCTCGAGCTATCCGCTCTGCATAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)