EMAIL THIS PAGE TO A FRIEND

HIST1H2AB

histone cluster 1, H2ab

28 Gene Product Result for
Synonyms: H2A/m H2AFM
UniProtKB ID: P04908, P28001, Q76P63
Gene ID:
Human(8335) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319172) histone cluster 1, H2ab
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003513 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003513 Rosetta Predictions human pricing
NM_175660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034059 predicted 241
2 SASI_Hs01_00034060 predicted 241
3 SASI_Hs01_00034061 predicted 52
4 SASI_Hs01_00034062 predicted 266
5 SASI_Hs01_00034063 predicted 368
6 SASI_Hs01_00034064 predicted 259
7 SASI_Hs01_00034065 predicted 263
8 SASI_Hs01_00034066 predicted 367
9 SASI_Hs01_00034067 predicted 46
10 SASI_Hs01_00034068 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038595 predicted 459
2 SASI_Mm01_00038596 predicted 58
3 SASI_Mm01_00038597 predicted 423
4 SASI_Mm01_00038598 predicted 458
5 SASI_Mm01_00038599 predicted 434
6 SASI_Mm01_00038600 predicted 447
7 SASI_Mm01_00038601 predicted 453
8 SASI_Mm01_00038602 predicted 447
9 SASI_Mm01_00038603 predicted 60
10 SASI_Mm01_00038604 predicted 447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003513
HIST1H2AB MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ab
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-273s1c1
Sequence:CCGGCGAGGAGCTTAATAAACTCTTCTCGAGAAGAGTTTATTAAGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-50s1c1
Sequence:CCGGCTCGGTCTTCTCGTGCAGGTTCTCGAGAACCTGCACGAGAAGACCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-58s1c1
Sequence:CCGGTCTCGTGCAGGTTTGCAGTTTCTCGAGAAACTGCAAACCTGCACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-43s1c1
Sequence:CCGGGCTAAGACTCGGTCTTCTCGTCTCGAGACGAGAAGACCGAGTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-265s1c1
Sequence:CCGGCGCAATGACGAGGAGCTTAATCTCGAGATTAAGCTCCTCGTCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003513
HIST1H2AB MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ab
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-273s1c1
Sequence:CCGGCGAGGAGCTTAATAAACTCTTCTCGAGAAGAGTTTATTAAGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-50s1c1
Sequence:CCGGCTCGGTCTTCTCGTGCAGGTTCTCGAGAACCTGCACGAGAAGACCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-58s1c1
Sequence:CCGGTCTCGTGCAGGTTTGCAGTTTCTCGAGAAACTGCAAACCTGCACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-43s1c1
Sequence:CCGGGCTAAGACTCGGTCTTCTCGTCTCGAGACGAGAAGACCGAGTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-265s1c1
Sequence:CCGGCGCAATGACGAGGAGCTTAATCTCGAGATTAAGCTCCTCGTCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003513
HIST1H2AB MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ab
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-273s1c1
Sequence:CCGGCGAGGAGCTTAATAAACTCTTCTCGAGAAGAGTTTATTAAGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-50s1c1
Sequence:CCGGCTCGGTCTTCTCGTGCAGGTTCTCGAGAACCTGCACGAGAAGACCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-58s1c1
Sequence:CCGGTCTCGTGCAGGTTTGCAGTTTCTCGAGAAACTGCAAACCTGCACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-43s1c1
Sequence:CCGGGCTAAGACTCGGTCTTCTCGTCTCGAGACGAGAAGACCGAGTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003513.2-265s1c1
Sequence:CCGGCGCAATGACGAGGAGCTTAATCTCGAGATTAAGCTCCTCGTCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175660
HIST1H2AB MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ab
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-198s1c1
Sequence:CCGGCCTGGCGGCTGTGCTGGAGTACTCGAGTACTCCAGCACAGCCGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-203s1c1
Sequence:CCGGCGGCTGTGCTGGAGTACCTGACTCGAGTCAGGTACTCCAGCACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-300s1c1
Sequence:CCGGGCTGGCCATCCGCAACGACGACTCGAGTCGTCGTTGCGGATGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-309s1c1
Sequence:CCGGCCGCAACGACGAGGAGCTCAACTCGAGTTGAGCTCCTCGTCGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-294s1c1
Sequence:CCGGCCTGCAGCTGGCCATCCGCAACTCGAGTTGCGGATGGCCAGCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175660
HIST1H2AB MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ab
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-198s1c1
Sequence:CCGGCCTGGCGGCTGTGCTGGAGTACTCGAGTACTCCAGCACAGCCGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-203s1c1
Sequence:CCGGCGGCTGTGCTGGAGTACCTGACTCGAGTCAGGTACTCCAGCACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-300s1c1
Sequence:CCGGGCTGGCCATCCGCAACGACGACTCGAGTCGTCGTTGCGGATGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-309s1c1
Sequence:CCGGCCGCAACGACGAGGAGCTCAACTCGAGTTGAGCTCCTCGTCGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-294s1c1
Sequence:CCGGCCTGCAGCTGGCCATCCGCAACTCGAGTTGCGGATGGCCAGCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175660
HIST1H2AB MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ab
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-198s1c1
Sequence:CCGGCCTGGCGGCTGTGCTGGAGTACTCGAGTACTCCAGCACAGCCGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-203s1c1
Sequence:CCGGCGGCTGTGCTGGAGTACCTGACTCGAGTCAGGTACTCCAGCACAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-300s1c1
Sequence:CCGGGCTGGCCATCCGCAACGACGACTCGAGTCGTCGTTGCGGATGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-309s1c1
Sequence:CCGGCCGCAACGACGAGGAGCTCAACTCGAGTTGAGCTCCTCGTCGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175660.1-294s1c1
Sequence:CCGGCCTGCAGCTGGCCATCCGCAACTCGAGTTGCGGATGGCCAGCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)