EMAIL THIS PAGE TO A FRIEND

HIST1H2AC

histone cluster 1, H2ac

48 Gene Product Result for
Synonyms: H2A/l H2AFL dJ221C16.4
Gene ID:
Human(8334) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319164) histone cluster 1, H2ac
Rat(306962) histone cluster 1, H2ac
cow(524808) histone cluster 1, H2ac
cow(506900) histone cluster 1, H2ac
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003512 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046231 MISSION® esiRNA esiRNA human HIST1H2AC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003512 Rosetta Predictions human pricing
XM_001062714 Rosetta Predictions rat pricing
XM_225372 Rosetta Predictions rat pricing
NM_178189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177241 predicted 471
2 SASI_Hs01_00177242 predicted 502
3 SASI_Hs01_00177243 predicted 374
4 SASI_Hs01_00177244 predicted 500
5 SASI_Hs01_00177245 predicted 509
6 SASI_Hs01_00177246 predicted 470
7 SASI_Hs01_00177248 predicted 485
8 SASI_Hs01_00177247 predicted 116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304342 predicted 333
2 SASI_Rn02_00304343 predicted 341
3 SASI_Rn02_00304344 predicted 340
4 SASI_Rn02_00304345 predicted 336
5 SASI_Rn02_00304346 predicted 405
6 SASI_Rn02_00304347 predicted 411
7 SASI_Rn02_00304348 predicted 482
8 SASI_Rn02_00304349 predicted 409
9 SASI_Rn02_00304350 predicted 559
10 SASI_Rn02_00304351 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382783 predicted 337
2 SASI_Rn02_00382784 predicted 341
3 SASI_Rn02_00382785 predicted 339
4 SASI_Rn02_00382786 predicted 345
5 SASI_Rn02_00382787 predicted 404
6 SASI_Rn02_00382788 predicted 405
7 SASI_Rn02_00382789 predicted 487
8 SASI_Rn02_00382790 predicted 415
9 SASI_Rn02_00382791 predicted 555
10 SASI_Rn02_00382792 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045254 predicted 534
2 SASI_Mm01_00045256 predicted 687
3 SASI_Mm01_00045257 predicted 672
4 SASI_Mm01_00045258 predicted 694
5 SASI_Mm01_00045259 predicted 649
6 SASI_Mm01_00045261 predicted 507
7 SASI_Mm01_00045262 predicted 439
8 SASI_Mm02_00348609 predicted 430
9 SASI_Mm01_00045263 predicted 603
10 SASI_Mm02_00348610 predicted 555
11 SASI_Mm01_00045255 predicted 691
12 SASI_Mm01_00045260 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178189
HIST1H2AC MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ac
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178189.2-1235s1c1
Sequence:CCGGGCCCAGAAACTGTGAAGATAACTCGAGTTATCTTCACAGTTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-407s1c1
Sequence:CCGGCGAGAGCCACCACAAGGCCAACTCGAGTTGGCCTTGTGGTGGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-140s1c1
Sequence:CCGGCCGGCTGCTCCGCAAGGGTAACTCGAGTTACCCTTGCGGAGCAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-143s1c1
Sequence:CCGGGCTGCTCCGCAAGGGTAACTACTCGAGTAGTTACCCTTGCGGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-149s1c1
Sequence:CCGGCCGCAAGGGTAACTACTCGGACTCGAGTCCGAGTAGTTACCCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-653s21c1
Sequence:CCGGGATAGATTGGGCAGCTTAAAGCTCGAGCTTTAAGCTGCCCAATCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-762s21c1
Sequence:CCGGGCCTACCACCTACTCCGTTATCTCGAGATAACGGAGTAGGTGGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-503s21c1
Sequence:CCGGAGTTGAACAGGATACTCTATTCTCGAGAATAGAGTATCCTGTTCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-688s21c1
Sequence:CCGGACTTCTGGTCTAAGCCGAATACTCGAGTATTCGGCTTAGACCAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178189
HIST1H2AC MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ac
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178189.2-1235s1c1
Sequence:CCGGGCCCAGAAACTGTGAAGATAACTCGAGTTATCTTCACAGTTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-407s1c1
Sequence:CCGGCGAGAGCCACCACAAGGCCAACTCGAGTTGGCCTTGTGGTGGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-140s1c1
Sequence:CCGGCCGGCTGCTCCGCAAGGGTAACTCGAGTTACCCTTGCGGAGCAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-143s1c1
Sequence:CCGGGCTGCTCCGCAAGGGTAACTACTCGAGTAGTTACCCTTGCGGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-149s1c1
Sequence:CCGGCCGCAAGGGTAACTACTCGGACTCGAGTCCGAGTAGTTACCCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-653s21c1
Sequence:CCGGGATAGATTGGGCAGCTTAAAGCTCGAGCTTTAAGCTGCCCAATCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-762s21c1
Sequence:CCGGGCCTACCACCTACTCCGTTATCTCGAGATAACGGAGTAGGTGGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-503s21c1
Sequence:CCGGAGTTGAACAGGATACTCTATTCTCGAGAATAGAGTATCCTGTTCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-688s21c1
Sequence:CCGGACTTCTGGTCTAAGCCGAATACTCGAGTATTCGGCTTAGACCAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178189
HIST1H2AC MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ac
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178189.2-1235s1c1
Sequence:CCGGGCCCAGAAACTGTGAAGATAACTCGAGTTATCTTCACAGTTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-407s1c1
Sequence:CCGGCGAGAGCCACCACAAGGCCAACTCGAGTTGGCCTTGTGGTGGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-140s1c1
Sequence:CCGGCCGGCTGCTCCGCAAGGGTAACTCGAGTTACCCTTGCGGAGCAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-143s1c1
Sequence:CCGGGCTGCTCCGCAAGGGTAACTACTCGAGTAGTTACCCTTGCGGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178189.2-149s1c1
Sequence:CCGGCCGCAAGGGTAACTACTCGGACTCGAGTCCGAGTAGTTACCCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-653s21c1
Sequence:CCGGGATAGATTGGGCAGCTTAAAGCTCGAGCTTTAAGCTGCCCAATCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-762s21c1
Sequence:CCGGGCCTACCACCTACTCCGTTATCTCGAGATAACGGAGTAGGTGGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-503s21c1
Sequence:CCGGAGTTGAACAGGATACTCTATTCTCGAGAATAGAGTATCCTGTTCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178189.3-688s21c1
Sequence:CCGGACTTCTGGTCTAAGCCGAATACTCGAGTATTCGGCTTAGACCAGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003512
VALIDATED
HIST1H2AC MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ac
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-126s1c1
Sequence:CCGGCCAAAGCGAAATCCCGCTCTTCTCGAGAAGAGCGGGATTTCGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003512.3-193s1c1
Sequence:CCGGCCGTAAAGGCAACTACGCAGACTCGAGTCTGCGTAGTTGCCTTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-125s1c1
Sequence:CCGGGCCAAAGCGAAATCCCGCTCTCTCGAGAGAGCGGGATTTCGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-362s1c1
Sequence:CCGGGAGGAGCTCAACAAACTGCTACTCGAGTAGCAGTTTGTTGAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-304s1c1
Sequence:CCGGCGACAACAAGAAGACTCGCATCTCGAGATGCGAGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-179s21c1
Sequence:CCGGGTGCACCGCCTGCTCCGTAAACTCGAGTTTACGGAGCAGGCGGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-362s21c1
Sequence:CCGGGAGGAGCTCAACAAACTGCTACTCGAGTAGCAGTTTGTTGAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-304s21c1
Sequence:CCGGCGACAACAAGAAGACTCGCATCTCGAGATGCGAGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003512.3-145s21c1
Sequence:CCGGTTCTCGCGCTGGTCTCCAGTTCTCGAGAACTGGAGACCAGCGCGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-256s21c1
Sequence:CCGGAGAGTACCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003512
VALIDATED
HIST1H2AC MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ac
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-126s1c1
Sequence:CCGGCCAAAGCGAAATCCCGCTCTTCTCGAGAAGAGCGGGATTTCGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003512.3-193s1c1
Sequence:CCGGCCGTAAAGGCAACTACGCAGACTCGAGTCTGCGTAGTTGCCTTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-125s1c1
Sequence:CCGGGCCAAAGCGAAATCCCGCTCTCTCGAGAGAGCGGGATTTCGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-362s1c1
Sequence:CCGGGAGGAGCTCAACAAACTGCTACTCGAGTAGCAGTTTGTTGAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-304s1c1
Sequence:CCGGCGACAACAAGAAGACTCGCATCTCGAGATGCGAGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-179s21c1
Sequence:CCGGGTGCACCGCCTGCTCCGTAAACTCGAGTTTACGGAGCAGGCGGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-362s21c1
Sequence:CCGGGAGGAGCTCAACAAACTGCTACTCGAGTAGCAGTTTGTTGAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-304s21c1
Sequence:CCGGCGACAACAAGAAGACTCGCATCTCGAGATGCGAGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003512.3-145s21c1
Sequence:CCGGTTCTCGCGCTGGTCTCCAGTTCTCGAGAACTGGAGACCAGCGCGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-256s21c1
Sequence:CCGGAGAGTACCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003512
VALIDATED
HIST1H2AC MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ac
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-126s1c1
Sequence:CCGGCCAAAGCGAAATCCCGCTCTTCTCGAGAAGAGCGGGATTTCGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003512.3-193s1c1
Sequence:CCGGCCGTAAAGGCAACTACGCAGACTCGAGTCTGCGTAGTTGCCTTTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-125s1c1
Sequence:CCGGGCCAAAGCGAAATCCCGCTCTCTCGAGAGAGCGGGATTTCGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-362s1c1
Sequence:CCGGGAGGAGCTCAACAAACTGCTACTCGAGTAGCAGTTTGTTGAGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003512.3-304s1c1
Sequence:CCGGCGACAACAAGAAGACTCGCATCTCGAGATGCGAGTCTTCTTGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-179s21c1
Sequence:CCGGGTGCACCGCCTGCTCCGTAAACTCGAGTTTACGGAGCAGGCGGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-362s21c1
Sequence:CCGGGAGGAGCTCAACAAACTGCTACTCGAGTAGCAGTTTGTTGAGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-304s21c1
Sequence:CCGGCGACAACAAGAAGACTCGCATCTCGAGATGCGAGTCTTCTTGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003512.3-145s21c1
Sequence:CCGGTTCTCGCGCTGGTCTCCAGTTCTCGAGAACTGGAGACCAGCGCGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003512.3-256s21c1
Sequence:CCGGAGAGTACCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)