EMAIL THIS PAGE TO A FRIEND

HIST1H2AD

histone cluster 1, H2ad

20 Gene Product Result for
Synonyms: H2A.3 H2A/g H2AFG
UniProtKB ID: P20671, A0PK91, P57754, Q6FGY6
Gene ID:
Human(3013) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319165) histone cluster 1, H2ad
cow(614970) histone cluster 1, H2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301257 ANTI-HIST1H2AD (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4504674 Anti-phospho-Histone H2A (pThr121) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021065 Rosetta Predictions human pricing
NM_178188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209446 predicted 395
2 SASI_Hs01_00209447 predicted 279
3 SASI_Hs01_00209448 predicted 13
4 SASI_Hs01_00209449 predicted 278
5 SASI_Hs01_00209450 predicted 138
6 SASI_Hs01_00209451 predicted 425
7 SASI_Hs01_00209452 predicted 287
8 SASI_Hs01_00209453 predicted 18
9 SASI_Hs01_00209455 predicted 49
10 SASI_Hs02_00354534 predicted 281
11 SASI_Hs01_00209454 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076007 predicted 15
2 SASI_Mm01_00076008 predicted 16
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021065
HIST1H2AD MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ad
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021065.2-304s21c1
Sequence:CCGGACAATTGCTCAGGGCGGTGTTCTCGAGAACACCGCCCTGAGCAATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021065.2-330s21c1
Sequence:CCGGCAACATCCAGGCTGTACTGCTCTCGAGAGCAGTACAGCCTGGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-219s1c1
Sequence:CCGGCAACAAGAAGACCCGCATCATCTCGAGATGATGCGGGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-38s1c1
Sequence:CCGGCTAAGGCTAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTAGCCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-288s1c1
Sequence:CCGGGTTGCTGGGTAAAGTCACAATCTCGAGATTGTGACTTTACCCAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021065
HIST1H2AD MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ad
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021065.2-304s21c1
Sequence:CCGGACAATTGCTCAGGGCGGTGTTCTCGAGAACACCGCCCTGAGCAATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021065.2-330s21c1
Sequence:CCGGCAACATCCAGGCTGTACTGCTCTCGAGAGCAGTACAGCCTGGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-219s1c1
Sequence:CCGGCAACAAGAAGACCCGCATCATCTCGAGATGATGCGGGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-38s1c1
Sequence:CCGGCTAAGGCTAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTAGCCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-288s1c1
Sequence:CCGGGTTGCTGGGTAAAGTCACAATCTCGAGATTGTGACTTTACCCAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021065
HIST1H2AD MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ad
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021065.2-304s21c1
Sequence:CCGGACAATTGCTCAGGGCGGTGTTCTCGAGAACACCGCCCTGAGCAATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021065.2-330s21c1
Sequence:CCGGCAACATCCAGGCTGTACTGCTCTCGAGAGCAGTACAGCCTGGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-219s1c1
Sequence:CCGGCAACAAGAAGACCCGCATCATCTCGAGATGATGCGGGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-38s1c1
Sequence:CCGGCTAAGGCTAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTAGCCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021065.2-288s1c1
Sequence:CCGGGTTGCTGGGTAAAGTCACAATCTCGAGATTGTGACTTTACCCAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178188
HIST1H2AD MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ad
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-113s21c1
Sequence:CCGGGCAACTACTCGGAGCGCGTGGCTCGAGCCACGCGCTCCGAGTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-219s21c1
Sequence:CCGGCAACAAGAAGACGCGCATCATCTCGAGATGATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-168s21c1
Sequence:CCGGGGAGTACCTGACGGCCGAGATCTCGAGATCTCGGCCGTCAGGTACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-29s21c1
Sequence:CCGGAGGCTCGCGCCAAGGCCAAGACTCGAGTCTTGGCCTTGGCGCGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-102s21c1
Sequence:CCGGGCTCCGCAAGGGCAACTACTCCTCGAGGAGTAGTTGCCCTTGCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178188
HIST1H2AD MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ad
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-113s21c1
Sequence:CCGGGCAACTACTCGGAGCGCGTGGCTCGAGCCACGCGCTCCGAGTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-219s21c1
Sequence:CCGGCAACAAGAAGACGCGCATCATCTCGAGATGATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-168s21c1
Sequence:CCGGGGAGTACCTGACGGCCGAGATCTCGAGATCTCGGCCGTCAGGTACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-29s21c1
Sequence:CCGGAGGCTCGCGCCAAGGCCAAGACTCGAGTCTTGGCCTTGGCGCGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-102s21c1
Sequence:CCGGGCTCCGCAAGGGCAACTACTCCTCGAGGAGTAGTTGCCCTTGCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178188
HIST1H2AD MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ad
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-113s21c1
Sequence:CCGGGCAACTACTCGGAGCGCGTGGCTCGAGCCACGCGCTCCGAGTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-219s21c1
Sequence:CCGGCAACAAGAAGACGCGCATCATCTCGAGATGATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-168s21c1
Sequence:CCGGGGAGTACCTGACGGCCGAGATCTCGAGATCTCGGCCGTCAGGTACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-29s21c1
Sequence:CCGGAGGCTCGCGCCAAGGCCAAGACTCGAGTCTTGGCCTTGGCGCGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178188.3-102s21c1
Sequence:CCGGGCTCCGCAAGGGCAACTACTCCTCGAGGAGTAGTTGCCCTTGCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)