EMAIL THIS PAGE TO A FRIEND

HIST1H2AE

histone cluster 1, H2ae

28 Gene Product Result for
Synonyms: H2A.1 H2A.2 H2A/a H2AFA
Gene ID:
Human(3012) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319166) histone cluster 1, H2ae
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107599 Anti-HIST1H2AE antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4504674 Anti-phospho-Histone H2A (pThr121) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021052 Rosetta Predictions human pricing
NM_178187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240636 predicted 210
2 SASI_Hs01_00240637 predicted 233
3 SASI_Hs01_00240638 predicted 225
4 SASI_Hs01_00240639 predicted 225
5 SASI_Hs01_00240640 predicted 324
6 SASI_Hs01_00240641 predicted 208
7 SASI_Hs01_00240642 predicted 201
8 SASI_Hs01_00240643 predicted 321
9 SASI_Hs01_00240644 predicted 337
10 SASI_Hs01_00240645 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128159 predicted 575
2 SASI_Mm01_00128160 predicted 548
3 SASI_Mm01_00128161 predicted 569
4 SASI_Mm01_00128162 predicted 584
5 SASI_Mm01_00128163 predicted 617
6 SASI_Mm01_00128164 predicted 545
7 SASI_Mm01_00128165 predicted 543
8 SASI_Mm01_00128166 predicted 666
9 SASI_Mm01_00128167 predicted 567
10 SASI_Mm01_00128168 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021052
HIST1H2AE MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ae
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-329s1c1
Sequence:CCGGGAGGAGCTAAATAAGCTTCTACTCGAGTAGAAGCTTATTTAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-328s1c1
Sequence:CCGGCGAGGAGCTAAATAAGCTTCTCTCGAGAGAAGCTTATTTAGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-271s1c1
Sequence:CCGGCGACAATAAGAAGACCCGCATCTCGAGATGCGGGTCTTCTTATTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-236s1c1
Sequence:CCGGGCCGAGATCTTAGAGCTAGCTCTCGAGAGCTAGCTCTAAGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-220s1c1
Sequence:CCGGGCTGGAATATCTGACGGCCGACTCGAGTCGGCCGTCAGATATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021052.2-119s21c1
Sequence:CCGGGCCGGTCTTCAGTTTCCAGTTCTCGAGAACTGGAAACTGAAGACCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021052.2-340s21c1
Sequence:CCGGTAAGCTTCTAGGTCGCGTGACCTCGAGGTCACGCGACCTAGAAGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021052
HIST1H2AE MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ae
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-329s1c1
Sequence:CCGGGAGGAGCTAAATAAGCTTCTACTCGAGTAGAAGCTTATTTAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-328s1c1
Sequence:CCGGCGAGGAGCTAAATAAGCTTCTCTCGAGAGAAGCTTATTTAGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-271s1c1
Sequence:CCGGCGACAATAAGAAGACCCGCATCTCGAGATGCGGGTCTTCTTATTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-236s1c1
Sequence:CCGGGCCGAGATCTTAGAGCTAGCTCTCGAGAGCTAGCTCTAAGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-220s1c1
Sequence:CCGGGCTGGAATATCTGACGGCCGACTCGAGTCGGCCGTCAGATATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021052.2-119s21c1
Sequence:CCGGGCCGGTCTTCAGTTTCCAGTTCTCGAGAACTGGAAACTGAAGACCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021052.2-340s21c1
Sequence:CCGGTAAGCTTCTAGGTCGCGTGACCTCGAGGTCACGCGACCTAGAAGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021052
HIST1H2AE MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ae
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-329s1c1
Sequence:CCGGGAGGAGCTAAATAAGCTTCTACTCGAGTAGAAGCTTATTTAGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-328s1c1
Sequence:CCGGCGAGGAGCTAAATAAGCTTCTCTCGAGAGAAGCTTATTTAGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-271s1c1
Sequence:CCGGCGACAATAAGAAGACCCGCATCTCGAGATGCGGGTCTTCTTATTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-236s1c1
Sequence:CCGGGCCGAGATCTTAGAGCTAGCTCTCGAGAGCTAGCTCTAAGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021052.2-220s1c1
Sequence:CCGGGCTGGAATATCTGACGGCCGACTCGAGTCGGCCGTCAGATATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021052.2-119s21c1
Sequence:CCGGGCCGGTCTTCAGTTTCCAGTTCTCGAGAACTGGAAACTGAAGACCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021052.2-340s21c1
Sequence:CCGGTAAGCTTCTAGGTCGCGTGACCTCGAGGTCACGCGACCTAGAAGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178187
HIST1H2AE MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ae
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178187.2-552s1c1
Sequence:CCGGGCCATTCACTTAATTCAGTAACTCGAGTTACTGAATTAAGTGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-212s1c1
Sequence:CCGGGCTGCTCCGCAAAGGCAACTACTCGAGTAGTTGCCTTTGCGGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-386s1c1
Sequence:CCGGCGAGGAGCTCAACAAGCTGCTCTCGAGAGCAGCTTGTTGAGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-464s1c1
Sequence:CCGGGCCCAAGAAGACCGAGAGCCACTCGAGTGGCTCTCGGTCTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-470s1c1
Sequence:CCGGGAAGACCGAGAGCCACCACAACTCGAGTTGTGGTGGCTCTCGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178187
HIST1H2AE MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ae
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178187.2-552s1c1
Sequence:CCGGGCCATTCACTTAATTCAGTAACTCGAGTTACTGAATTAAGTGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-212s1c1
Sequence:CCGGGCTGCTCCGCAAAGGCAACTACTCGAGTAGTTGCCTTTGCGGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-386s1c1
Sequence:CCGGCGAGGAGCTCAACAAGCTGCTCTCGAGAGCAGCTTGTTGAGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-464s1c1
Sequence:CCGGGCCCAAGAAGACCGAGAGCCACTCGAGTGGCTCTCGGTCTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-470s1c1
Sequence:CCGGGAAGACCGAGAGCCACCACAACTCGAGTTGTGGTGGCTCTCGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178187
HIST1H2AE MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ae
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178187.2-552s1c1
Sequence:CCGGGCCATTCACTTAATTCAGTAACTCGAGTTACTGAATTAAGTGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-212s1c1
Sequence:CCGGGCTGCTCCGCAAAGGCAACTACTCGAGTAGTTGCCTTTGCGGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-386s1c1
Sequence:CCGGCGAGGAGCTCAACAAGCTGCTCTCGAGAGCAGCTTGTTGAGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-464s1c1
Sequence:CCGGGCCCAAGAAGACCGAGAGCCACTCGAGTGGCTCTCGGTCTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178187.2-470s1c1
Sequence:CCGGGAAGACCGAGAGCCACCACAACTCGAGTTGTGGTGGCTCTCGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)