EMAIL THIS PAGE TO A FRIEND

HIST1H2AG

histone cluster 1, H2ag

51 Gene Product Result for
Synonyms: H2A.1b H2A/p H2AFP H2AG pH2A/f
UniProtKB ID: P0C0S8, P02261, Q2M1R2, Q76PA6
Gene ID:
Human(8969) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the histone microcluster on chromosome 6p21.33. [provided by RefSeq, Jul 2008]
Mouse(319167) histone cluster 1, H2ag
cow(616790) histone cluster 1, H2ag
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021064 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020091 MISSION® esiRNA esiRNA human HIST1H2AG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021064 Rosetta Predictions human pricing
NM_178186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051897 predicted 542
2 SASI_Hs01_00051898 predicted 660
3 SASI_Hs01_00051900 predicted 655
4 SASI_Hs01_00051901 predicted 770
5 SASI_Hs01_00051902 predicted 424
6 SASI_Hs01_00051903 predicted 864
7 SASI_Hs01_00051904 predicted 586
8 SASI_Hs02_00354533 predicted 410
9 SASI_Hs01_00051905 predicted 775
10 SASI_Hs01_00051906 predicted 672
11 SASI_Hs01_00051899 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199090 predicted 426
2 SASI_Mm01_00199091 predicted 429
3 SASI_Mm01_00199092 predicted 410
4 SASI_Mm01_00199093 predicted 24
5 SASI_Mm01_00199094 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178186
HIST1H2AG MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ag
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000242131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-274s21c1
Sequence:CCGGGCAGCTGGCCATCCGCAACGACTCGAGTCGTTGCGGATGGCCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-352s21c1
Sequence:CCGGCAACATCCAGGCCGTGCTGCTCTCGAGAGCAGCACGGCCTGGATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-289s21c1
Sequence:CCGGCAACGACGAGGAGCTCAACAACTCGAGTTGTTGAGCTCCTCGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178186
HIST1H2AG MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ag
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000242131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-274s21c1
Sequence:CCGGGCAGCTGGCCATCCGCAACGACTCGAGTCGTTGCGGATGGCCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-352s21c1
Sequence:CCGGCAACATCCAGGCCGTGCTGCTCTCGAGAGCAGCACGGCCTGGATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-289s21c1
Sequence:CCGGCAACGACGAGGAGCTCAACAACTCGAGTTGTTGAGCTCCTCGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178186
HIST1H2AG MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ag
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000242131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-274s21c1
Sequence:CCGGGCAGCTGGCCATCCGCAACGACTCGAGTCGTTGCGGATGGCCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-352s21c1
Sequence:CCGGCAACATCCAGGCCGTGCTGCTCTCGAGAGCAGCACGGCCTGGATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178186.2-289s21c1
Sequence:CCGGCAACGACGAGGAGCTCAACAACTCGAGTTGTTGAGCTCCTCGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021064
VALIDATED
HIST1H2AG MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ag
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021064.3-1133s1c1
Sequence:CCGGCCCAAGAAAGATGGCTCATTTCTCGAGAAATGAGCCATCTTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021064.3-358s1c1
Sequence:CCGGCCCAACATTCAGGCCGTGCTACTCGAGTAGCACGGCCTGAATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021064.3-399s1c1
Sequence:CCGGCCACCACAAGGCGAAGGGCAACTCGAGTTGCCCTTCGCCTTGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021064.3-246s1c1
Sequence:CCGGCGACAACAAGAAGACCCGCATCTCGAGATGCGGGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021064.3-71s1c1
Sequence:CCGGAGGCCAAGACTCGCTCTTCTACTCGAGTAGAAGAGCGAGTCTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021064
VALIDATED
HIST1H2AG MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ag
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021064.3-1133s1c1
Sequence:CCGGCCCAAGAAAGATGGCTCATTTCTCGAGAAATGAGCCATCTTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021064.3-358s1c1
Sequence:CCGGCCCAACATTCAGGCCGTGCTACTCGAGTAGCACGGCCTGAATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021064.3-399s1c1
Sequence:CCGGCCACCACAAGGCGAAGGGCAACTCGAGTTGCCCTTCGCCTTGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021064.3-246s1c1
Sequence:CCGGCGACAACAAGAAGACCCGCATCTCGAGATGCGGGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021064.3-71s1c1
Sequence:CCGGAGGCCAAGACTCGCTCTTCTACTCGAGTAGAAGAGCGAGTCTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021064
VALIDATED
HIST1H2AG MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ag
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021064.3-1133s1c1
Sequence:CCGGCCCAAGAAAGATGGCTCATTTCTCGAGAAATGAGCCATCTTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021064.3-358s1c1
Sequence:CCGGCCCAACATTCAGGCCGTGCTACTCGAGTAGCACGGCCTGAATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021064.3-399s1c1
Sequence:CCGGCCACCACAAGGCGAAGGGCAACTCGAGTTGCCCTTCGCCTTGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021064.3-246s1c1
Sequence:CCGGCGACAACAAGAAGACCCGCATCTCGAGATGCGGGTCTTCTTGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021064.3-71s1c1
Sequence:CCGGAGGCCAAGACTCGCTCTTCTACTCGAGTAGAAGAGCGAGTCTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)